Skip Navigation



NDT Advance Access published online on October 8, 2008
Nephrology Dialysis Transplantation, doi:10.1093/ndt/gfn562
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
24/3/801    most recent
gfn562v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Roelofs, J. J. T. H.
Right arrow Articles by Florquin, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Roelofs, J. J. T. H.
Right arrow Articles by Florquin, S.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author [2008]. Published by Oxford University Press on behalf of ERA-EDTA. All rights reserved. For Permissions, please e-mail: journals.permissions@oxfordjournals.org


Endogenous tissue-type plasminogen activator is protective during ascending urinary tract infection

Joris J. T. H. Roelofs1, Kasper M. A. Rouschop1,4, Gwendoline J. D. Teske1, Gerry T. M. Wagenaar2, Nike Claessen1, Jan J. Weening1, Tom van der Poll3 and Sandrine Florquin1

1 Department of Pathology, Academic Medical Center, University of Amsterdam, Amsterdam 2 Department of Pediatrics, Leiden University Medical Center, Leiden 3 Center for Experimental and Molecular Medicine, Academic Medical Center, University of Amsterdam, Amsterdam, The Netherlands

Correspondence and offprint requests to: Joris J. T. H. Roelofs, Department of Pathology, Room H2-131, Academic Medical Center, Meibergdreef 9, 1105 AZ Amsterdam, The Netherlands. Tel: +31-20-5669111; Fax: +31-20-5669523; E-mail: j.j.roelofs{at}amc.uva.nl



   Abstract
Top
 Abstract
Introduction
 Methods
 Results
 Discussion
 References
 
Background. Acute pyelonephritis is one of the most common bacterial infections. Tissue-type plasminogen activator (tPA) is a potent fibrinolytic agent, but can play a role in inflammatory processes as well.

Methods. We induced pyelonephritis in tPA–/– and C57BL/6 wild-type (WT) mice by intravesical inoculation with 1010 CFU uropathogenic Escherichia coli 1677. The mice were killed after 24 and 48 h, after which bacterial outgrowth and cytokine levels in kidney homogenates were determined. Influx of neutrophils was quantified by myeloperoxidase-ELISA. Neutrophil phagocytosis and oxidative burst were measured.

Results. The tPA–/– kidneys contained significantly higher numbers of E. coli CFU, accompanied by higher levels of interleukin-1β (IL-1β) and tumour necrosis factor-{alpha} (TNF-{alpha}). The number of infiltrating neutrophils was similar in tPA–/– and WT mice at both time points, suggesting that tPA–/– neutrophils have a lower ability to eliminate E. coli. Phagocytosis of E. coli organisms was not diminished in tPA–/– neutrophils. Interestingly, tPA–/– neutrophils showed a significantly lower ability to generate an oxidative burst reaction upon stimulation with E. coli than WT neutrophils. Incubation with recombinant tPA reversed this effect completely.

Conclusions. These results show that deletion of the tPA-gene in mice leads to lower bactericidal potential of tPA–/– neutrophils, which results in significantly more bacterial outgrowth during experimental pyelonephritis.

Keywords: fibrinolytic system; neutrophil; pyelonephritis; oxidative burst; tissue-type plasminogen activator



   Introduction
Top
 Abstract
 Introduction
Methods
 Results
 Discussion
 References
 
Urinary tract infections (UTI), most frequently caused by Gram-negative Escherichia coli, are among the most common bacterial infections, affecting ~50% of women at one point in their lifetime [1], while recurrent UTI afflict ~10% of women [1]. Also, UTI form a considerable clinical problem for paediatricians since 8% of girls and 2% of boys under the age of 7 develop acute pyelonephritis [2]. When left untreated, pyelonephritis may lead to renal fibrosis and subsequent end-stage renal failure [3].

The dynamical balance between bacterial virulence factors and host defence mechanisms determines the outcome of UTI. Virulence factors that are linked to uropathogenicity of E. coli comprise type 1 fimbriae, P fimbriae, haemolysin and aerobactin. Fimbriae are adhesins that assist the attachment of E. coli to the urothelium (type 1 fimbriae) and to glycolipids on resident kidney cells (P fimbriae). Haemolysin assists E. coli tissue invasion and lysis of host leukocytes, whereas aerobactin is a siderophore that ensures bacterial metabolism in low-iron environments such as urine and serum [4].

Host defence mechanisms against UTI include non-specific factors such as regular bladder voiding and antimicrobial peptides such as β-defensin 1, which is expressed by tubular epithelial cells and has been reported to be protective against UTI [5]. Upon adhesion of uropathogenic bacteria to the urothelium, complement activation and generation of pro-inflammatory cytokines and chemokines lead to recruitment of neutrophils that ingest and kill E. coli organisms [6]. Killing of bacteria by neutrophils depends on the capacity of these cells to produce an oxidative burst. The generation of reactive oxygen species (ROS) results from activation of the nicotinamide adenine dinucleotide phosphate (NADPH) oxidase, a multiprotein enzyme complex that transfers a single electron from NADPH to oxygen, resulting in the production of superoxide (O2–) and subsequent generation of hydrogen peroxide (H2O2) [7]. Neutrophil myeloperoxidase (MPO) reacts with O2– and H2O2 to generate highly reactive hypochlorous acid (HOCl) [8].

The fibrinolytic system consists of two serine proteases, tissue-type plasminogen activator (tPA) and urokinase-type plasminogen activator (uPA) that both facilitate the conversion of plasminogen into plasmin, which is the key protease in the fibrinolytic cascade [9]. In the kidney, tPA is constitutively expressed by endothelial cells, glomerular cells and epithelial cells of the distal collecting duct [10]. Under inflammatory conditions, tPA can be expressed by proximal tubules as well [11].

In recent years, it has become increasingly clear that components of the fibrinolytic system can exert functions that exceed their familiar proteolytic tasks. Recently, it has been demonstrated that tPA has the ability to initiate cell signalling cascades in renal fibroblasts after interaction with the low-density lipoprotein receptor-related protein-1 (LRP-1) [12]. The tPA-LRP-1 interaction resulted in tyrosine phosphorylation on the beta subunit of LRP-1, which was followed by the activation of Mek1, Erk-1/2 and subsequent induction of matrix metalloproteinase 9 (MMP-9) gene expression [12]. In this way tPA has proven to act in a cytokine-like manner, in a plasmin-independent fashion. In a previous study on renal ischaemia-reperfusion injury, we have shown that tPA deficiency resulted in reduced neutrophil influx, leading to quicker recovery of renal function after ischaemia [11]. Again, this effect was independent from proteolytic activity. Furthermore, we were able to define endogenous tPA as an important protective factor during E. coli-induced abdominal sepsis [13].

In order to investigate the in vivo role of tPA during UTI, we induced acute pyelonephritis in tPA-deficient mice by intravesical inoculation with uropathogenic E. coli. In the present study, we demonstrate that deletion of the tPA gene in mice leads to higher bacterial load during experimental pyelonephritis, partly caused by an impaired ability to generate an oxidative burst by tPA–/– neutrophils.



   Methods
Top
 Abstract
 Introduction
 Methods
Results
 Discussion
 References
 
Mice and experimental protocol
The tPA–/– mice on a C57BL/6J background were purchased from The Jackson Laboratory (Bar Harbor, Maine) and bred in the institutional animal facilities. Age- and weight-matched C57Bl/6 mice (Charles River, Maastricht, The Netherlands) served as a wild-type (WT) control.

UTI was induced as described previously [14,15]. E. coli 1677, isolated from a uroseptic patient, was donated by Dr W. J. Hopkins (University of Wisconsin Medical School, Madison, WI, USA). This strain has virulence factors that include type 1 and P fimbriae, haemolysin and aerobactin [16]. This specific serotype has proven uropathogenicity in mice [14,16]. Bacteria were cultured for 16 h at 37°C in the trypticase soy broth (TSB). After dilution 1:100 in fresh TSB, the suspension was grown for 3 h to midlogarithmic phase. E. coli were washed three times in sterile PBS. The bacteria were resuspended in PBS at a concentration of 1 x 1011 colony-forming units (CFU)/mL, as determined by plating 10-fold serial dilutions of the suspension on blood agar plates. Acute pyelonephritis was induced under general anesthesia [0.07 mL/10 g mouse of FFM mixture, containing 1.25 mg/mL midazolam (Roche, Mijdrecht, The Netherlands), 0.08 mg/mL fentanyl citrate and 2.5 mg/mL fluanisone (Janssen Pharmaceutica, Beerse, Belgium)] in 8- to 10-week-old female mice. Hundred microlitres of bacterial suspension (1 x 1010 CFU) was administered transurethrally through a 0.55 mm catheter (Abbott, Zwolle, The Netherlands). Sham control mice underwent the same procedure with administration of 100 µL of sterile PBS instead of bacterial suspension. Mice were killed 24 h (n = 7 per group) and 48 h (n = 8 per group) after the procedure by exsanguination under general anaesthesia. The choice of these time points was based on the literature and on our own broad experience with this model [14–17]. Under normal circumstances, C57Bl/6 mice have the ability to clear an infection with this E. coli strain during 48 h [16]. White blood cell counts (WBC) in peripheral blood were determined using a haemocytometer (Beckman Coulter, Fullerton, CA, USA). The Committee on Use and Care of Animals of the Academic Medical Center at the University of Amsterdam approved all experiments. Animal experimentation guidelines were followed in all experiments.

Determination of bacterial outgrowth
Bacterial load was determined in renal tissue and blood as described earlier [14,15]. One-half of the left kidney from each mouse was homogenized in four volumes of sterile saline with a tissue homogenizer that was cleaned with 70% ethanol after each homogenization. Serial 10-fold dilutions were made in sterile saline, and 50 µL volumes of kidney homogenate and blood were plated onto blood agar plates, which were incubated at 37°C for 16 h, after which E. coli CFU were counted.

Histology and determination of fibrin deposition
The remaining part of the left kidney was fixed in 10% formalin and embedded in paraffin. Sections were stained with haematoxylin and eosin in a standard fashion. For fibrin immunostaining 4-µm sections were pretreated with 0.1% trypsin (Sigma) at 37°C for 30 min. Endogenous peroxidase activity was quenched by 0.1% NaN3/0.03% H2O2 and free protein-binding sites were blocked with 10% normal goat serum. After incubation with biotin-labelled anti-mouse fibrin(ogen) (Ixell; Accurate Chemical & Scientific, Westbury, NY, USA) slides were incubated with a streptavidine/biotinylated horseradish peroxidase (HRP) mixture (StreptABComplex, DAKO, Glostrup, Denmark). The bound HRP was visualized using 3,3-diamino-benzidine tetrachloride (DAB, Sigma). Fibrin deposits in renal tissue were quantified by western blot analysis as described previously [18,19]. After electrophoresis of kidney homogenates by SDS–PAGE, proteins were blotted onto a PVDF membrane (Immobilon-P, Millipore, Bredford, MA, USA). The 56-kDa fibrin β-chains were detected with a monoclonal anti-human fibrin antibody (59D8, Boston Research Services, Winchester, MA, USA) that specifically recognizes fibrin β-chains, and not fibrinogen [20].

Cytokine and MPO measurements
The right kidney of each mouse was homogenated in PBS containing 1% Triton X-100, 1 mM EDTA (Merck) and 1% protease inhibitor cocktail (P8340, Sigma). Levels of interleukin-1β (IL-1β), tumour necrosis factor-{alpha} (TNF-{alpha}), keratinocyte-derived chemokine (KC), macrophage inflammatory protein-2 (MIP-2) and mouse MPO in kidney homogenates were measured by specific ELISA according to the instructions of the manufacturer (IL-1β and TNF-{alpha}: R&D systems, Minneapolis, MN; MPO: HyCult biotechnologies, Uden, The Netherlands). Total protein content of the samples was determined according to the method of Bradford [21], using a commercially available protein assay kit (Bio-Rad, Hercules, CA, USA).

Real-time quantitative PCR analysis
Real-time quantitative (Q) PCR analysis was performed using RNA obtained from kidneys from WT and tPA–/– mice, at T = 24 h. Total RNA was isolated using TRIzol® LS Reagent (Invitrogen—Life Technologies, The Netherlands), following the manufacturer's instructions. The concentration and purity of RNA were determined spectrophotometrically at 260/280 nm. Five micrograms of total RNA was reverse-transcribed into cDNA using oligo dT primers (Roche). Primer sets used were for tPA: forward ATGAGGCATCGTCTCCATTC, reverse CATGTTGTTC GTGACGGTTT; IL-1β: forward CTGCAGCTGGAGAG TGTGGAT, reverse GCTTGTGCTCTGCTTGTGAG; TNF-{alpha}: forward TCGTAGCAAACCACCAAGTG, reverse CCTTGTCCCTTGAAGAGAACC; KC: forward ATAATGGGCTTTTACATTCTTTAACC, reverse AG TCCTTTGAACGTCTCTGTCC; MIP-2: forward CCCTGGTTCAGAAAATCATCC, reverse CTTCCGTTGAGGGACAGC. TBP was used as housekeeping gene: forward GGAGAATCATGGACCAGAACA, reverse GATGGGAATTCCAGGAGTCA. QPCR was performed with a LightCycler® LC480 (Roche). For the PCR, a master mixture was prepared on ice, containing per sample 1 µL of cDNA, 1 µL of FastStart Reaction Mix SYBR Green I (Roche Applied Science, Indianapolis, IN, USA), 0.5 µL of 10 µM primers and 1.6 µL of 25 mM MgCl2. After the reaction mixture was loaded into a glass capillary tube, the cycling conditions were carried out as follows: initial denaturation at 95°C for 6 min, followed by 45 cycles of denaturation at 95°C for 15 s, annealing at 55–60°C for 5–10 s and extension at 72°C for 8–12 s. The temperature transition rate was set at 20°C/s. The fluorescent product was measured by a single acquisition mode at 72°C after each cycle. Quantification of data was performed using standard Light Cycler analysis software. The amount of amplified tPA and cytokine products was divided by the amount of TBP for each sample.

Phagocytosis assay and oxidative burst
Expression of eGFP was induced in E. coli strains Top-10 and DH10B (both Invitrogen, Breda, The Netherlands), by transfection with pBBR1MCS-5-eGFP (clone pMP2463) [22], which was kindly provided by Professor H. Spaink (Leiden University, Leiden, The Netherlands). Bacteria were grown under high selective pressure (40 µg/mL gentamycin, Sigma). GFP expression was confirmed by flow cytometry and fluorescent microscopy. The phagocytosis capacity of WT and tPA–/– neutrophils was determined by flow cytometry. In short, GFP-E. coli (equivalent to 50 x 103 CFU) was added to 50 µL of heparinized full blood from WT or tPA–/– mice and allowed to incubate for 5, 10, 15 or 20 min, vigorously shaking in a water bath at 37°C. Phagocytosis was stopped by immediately transferring the samples to ice. Erythrocytes were lysed using a hypotonic lysis buffer and neutrophils were labelled using anti-Ly6-G-APC (Pharmingen). To exclude the influence of cell surface-adhering bacteria extensive washing steps were included. Samples were washed with an ice-cold FACS buffer after which the degree of phagocytosis was determined using a flow cytometer (FACScalibur®, Becton Dickinson, Franklin Lakes, NJ, USA). Results are expressed as mean fluorescence intensity (MFI) per neutrophil.

Oxidative burst of neutrophils was assessed by dihydrorhodamine 123 (Sigma) measurement according to Kampen et al. [23]. In short, circulating cells (50 µL whole blood form WT or tPA–/– mice) were loaded with 1.5 mg/ mL dihydrorhodamine 123 for 30 min. Neutrophils were stimulated by addition of 50 x 106 CFU E. coli 1677/mL for 30 min, with or without recombinant murine tPA (Molecular Innovations Inc., Southfield, MI, USA) at a concentration of 100 ng/mL. After red blood cell lysis, the conversion of dihydrorhodamine was determined by flow cytometry.

Statistical analysis
All data are presented as means ± standard error of the mean (SEM). Data were analysed by the Mann–Whitney U-test or unpaired Student's t-test when appropriate. P < 0.05 was considered to represent a statistically significant difference.



   Results
Top
 Abstract
 Introduction
 Methods
 Results
Discussion
 References
 
tPA is upregulated during urinary tract infection
To gain insight in the production of tPA during E. coli-induced acute pyelonephritis, we measured renal tPA concentration at mRNA level during acute pyelonephritis. At T = 24 h after infection tPA mRNA levels were significantly elevated, compared to sham mice (Figure 1).


Figure 1
View larger version (8K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 1 Upregulation of tPA during pyelonephritis. Infected mice show significantly higher renal levels of tPA mRNA than uninfected (sham) mice at T = 24 h after inoculation. mRNA levels were determined by quantitative PCR. **P < 0.01.

 
tPA–/– mice display higher bacterial load than WT mice
To determine the role of tPA in UTI, acute pyelonephritis was induced in tPA–/– and WT mice, and renal bacterial loads were determined 24 and 48 h after infection. At both time points, tPA–/– mice showed a significantly higher number of E. coli CFU in kidney homogenates than WT mice (Figure 2), indicating that tPA–/– mice had a seriously impaired ability to clear E. coli-caused pyelonephritis. Blood cultures remained negative in all mice.


Figure 2
View larger version (8K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 2 Higher bacterial outgrowth in tPA–/– mice. At T = 24 h and T = 48 h after inoculation tPA–/– mice (Figure 2) show higher numbers of E. coli CFU than WT mice (Figure 2). Horizontal lines represent medians, Mann–Whitney U-test, *P < 0.05; **P < 0.01.

 
tPA–/– mice have higher levels of IL-1β and TNF-{alpha} during pyelonephritis
In order to investigate whether increased bacterial outgrowth in kidneys of tPA–/– mice was accompanied by higher levels of pro-inflammatory cytokines and chemokines, we determined levels of IL-1β, TNF-{alpha}, KC and MIP-2 in kidney homogenates by QPCR and ELISA.

Both WT and tPA–/– kidneys showed upregulation of IL-1β, TNF-{alpha} and MIP-2 mRNA at 24 h. As shown in Table 1, tPA–/– kidneys contained higher amounts of IL-1β and TNF-{alpha} mRNA than WT kidneys.


View this table:
[in this window]
[in a new window]

  		Table 1 Gene expression of pro-inflammatory cytokines by QPCR

 
Protein levels of these cytokines were determined by ELISA. Measurements are shown in Table 2. At both 24 and 48 h after infection tPA–/– kidneys displayed significantly higher levels of IL-1β and TNF-{alpha} than WT kidneys (Table 2). In contrast, levels of KC and MIP-2 did not differ significantly between tPA–/– and WT kidneys (Table 2).


View this table:
[in this window]
[in a new window]

  		Table 2 Higher cytokine levels in tPA–/– kidneys

 
No difference in neutrophil influx and fibrin in tPA–/– and WT mice
An essential part of host defence against invading bacteria is the recruitment of leukocytes to the site of infection. Therefore, histological sections of renal tissue were examined to investigate the extent of inflammation. Both WT and tPA–/– mice showed a massive inflammatory infiltrate pyelum region, consisting almost exclusively of neutrophils (Figure 3A–B). To quantify the influx of neutrophils, MPO measurements on kidney homogenates were performed by ELISA. At both time points, no significant differences in MPO levels of tPA–/– and WT mice were encountered, despite higher levels of pro-inflammatory cytokines in tPA–/– mice compared to WT mice (Figure 3C). Although neutrophil influx in the kidney was the same, leukocyte counts (WBC) in peripheral blood were significantly higher in tPA–/– mice than in WT mice at both time points (24 h: 4.5 x 106 ± 0.4 x 106 (tPA–/–) versus 3.0 x 106 ± 0.5 x 106 (WT), P < 0.05; 48 h: 5.2 x 106 ± 0.5 x 106 (tPA–/–) versus 2.5 x 106 ± 0.1 x 106 (WT); number of leukocytes/mL, P < 0.001). Moreover, there were no differences in WBC before infection between tPA–/– and WT mice (data not shown).


Figure 3
View larger version (32K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 3 Histology and renal myeloperoxidase levels. Photomicrographs of tPA–/– kidney (A) and WT kidney (B). Both tPA–/– and WT kidneys show a dense inflammatory infiltrate in the pyelum region. The infiltrate consists chiefly of neutrophils. T = 24 h after inoculation, H&E staining, original magnifications x200. (C) At T = 24 h and T = 48 h after inoculation MPO levels were not different between tPA–/– (Figure 3) and WT (Figure 3) mice. Data expressed as mean ± SEM; Mann–Whitney U-test, P > 0.05.

 
Since tPA is the principal fibrinolytic agent, the extent of renal fibrin deposition was determined by western blotting and fibrin immunostainings. No significant fibrin deposits were encountered using both methods.

tPA–/– neutrophils have a lower bactericidal potential than WT neutrophils
Although tPA–/– and WT mice showed the same numbers of intra-renal neutrophils, tPA–/– mice displayed higher numbers of E. coli CFU, suggesting that tPA–/– neutrophils had an impaired ability to eliminate E. coli. In order to further investigate this, a phagocytosis assay was performed with tPA–/– and WT neutrophils. As shown in Figure 4, tPA–/– and WT neutrophils had the same ability to phagocytose two different E. coli strains. Both types of neutrophils showed a comparable increase in MFI, representing the number of ingested green fluorescent protein (GFP)-E. coli organisms.


Figure 4
View larger version (10K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 4 tPA–/– and WT neutrophils have similar phagocytic potential. tPA–/– neutrophils (Figure 4) display the same capacity to ingest GFP-E. coli strains DH10B and top 10 as WT neutrophils (Figure 4). Data expressed as mean fluorescence intensity (MFI) per neutrophil (representing the number of phagocytosed GFP-E. coli), mean MFI ± SEM; Student's t-test, P = ns. Data represent three independent experiments.

 
Further, we determined neutrophil potential to generate an oxidative burst reaction. The basal production of oxidative products in unchallenged neutrophils was similar in WT and tPA–/– cells. Upon activation with uropathogenic E. coli, tPA–/– neutrophils displayed a diminished ability to produce an oxidative burst when compared to WT neutrophils (Figure 5). As shown in Figure 5, the addition of recombinant murine tPA reversed this effect completely.


Figure 5
View larger version (11K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 5 Lower oxidative burst of tPA–/– neutrophils. tPA–/– (Figure 5) neutrophils generate a significantly lower oxidative burst upon stimulation with E. coli 1677 than WT (Figure 5) neutrophils. The addition of 100 ng/mL of recombinant murine tPA to tPA–/– neutrophils (tPA–/– + tPA) restores the generation of an oxidative burst. Data expressed as percentage of WT mean fluorescence intensity (MFI), mean MFI ± SEM; Student's t-test, *P < 0.05 versus WT. Data represent three independent experiments.

 


   Discussion
Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
References
 
Acute pyelonephritis is one of the most commonly encountered infectious diseases and knowledge on its pathophysiology is still increasing. Numerous host factors have been implicated in host defence against E. coli pyelonephritis. Among the various components of the fibrinolytic system, only the uPA receptor (uPAR) has been implicated in host defence against UTI. Expression of uPAR is markedly elevated in urine and plasma of patients with culture-proven urosepsis [24]. In addition, we have shown that uPAR–/– mice experience more severe disease with higher bacterial outgrowth than WT mice during experimental pyelonephritis [15]. The present study shows that endogenous tPA is also involved in host defence against acute pyelonephritis. Indeed, tPA–/– mice have a seriously impaired bacterial clearance.

It has become increasingly clear that tPA can be an active modulator of inflammatory responses in a variety of inflammatory conditions [11–13,25–30]. Only a very limited number of studies, however, deal with the involvement of tPA in host defence against micro-organisms. One report concerning a murine model of systemic Mycobacterium avium infection described no differences in total bacterial outgrowth between tPA–/– and WT mice although in tPA–/– mice dissemination of mycobacteria occurred earlier than in WT mice [31]. Recently, we described that endogenous tPA is an important protective factor during E. coli-induced abdominal sepsis [13]. After intraperitoneal inoculation, tPA–/– mice demonstrated higher bacterial load at the site of infection, enhanced E. coli dissemination and reduced survival. The results of the present study are in line with these findings.

The increased outgrowth of E. coli in tPA–/– kidneys was associated with higher levels of intra-renal IL-1β and TNF-{alpha}. It is likely that resident kidney cells contribute to cytokine production in this model. Indeed, after inoculation with uropathogenic E. coli, bladder and tubular epithelial cells have been shown to produce several pro-inflammatory cytokines and chemokines, among which IL-1β and TNF-{alpha} [32]. In a previous study we demonstrated that renal cytokine levels are directly correlated to the amount of CFU in this model [15].

Despite higher levels of pro-inflammatory cytokines in tPA–/– kidneys and higher numbers of circulating leukocytes in tPA–/– mice upon UTI, the amount of infiltrating neutrophils in tPA–/– and WT kidneys did not differ in this model. This finding is most probably related to the relatively impaired migration capacity of tPA–/– neutrophils and the similar levels of KC and MIP-2. The mouse CXC chemokines KC and MIP-2 play a major role in the attraction of neutrophils during inflammation [33]. A relatively impaired migratory ability of tPA–/– neutrophils has also been observed in a model of renal ischaemia-reperfusion injury, in which tPA deficiency resulted in a diminished neutrophil infiltration into post-ischaemic renal tissue despite equal levels of pro-inflammatory cytokines and chemokines [11]. In a model of E. coli-induced peritonitis numbers of intra-peritoneal neutrophils were similar in tPA–/– and WT mice despite higher numbers of bacteria and higher cytokine levels in tPA–/– mice [13]. During thioglycolate-induced peritonitis, tPA–/– mice also demonstrated a reduced influx of neutrophils into the abdominal cavity. In addition, mice that over-expressed tPA showed significantly increased numbers of intra-peritoneal neutrophils during E. coli peritonitis relative to mice with normal tPA levels [13]. Taken together, these studies suggest that tPA actively favours neutrophil migration. In contrast with the abovementioned studies, in a model of sterile arthritis tPA–/– mice experienced more severe joint disease associated with increased fibrin deposition and higher numbers of infiltrating neutrophils [29,30]. Furthermore, in a model of crescentic glomerulonephritis, tPA–/– mice displayed more fibrin deposits, worse renal function and significantly higher numbers of intra-glomerular inflammatory cells [25]. Since fibrin has been implicated in the pathogenesis of both arthritis and glomerulonephritis [34,35], fibrin deposition parallels disease severity in these models. In the present study no appreciable fibrin deposits were present, suggesting that fibrin is not crucially involved in the pathophysiology of pyelonephritis. Furthermore, the abundant expression of uPA in the tubulointerstitial compartment of the kidney is likely to compensate fully for tPA deficiency [11].

Crucial steps in the clearance of bacterial infections are phagocytosis and subsequent killing of bacteria by means of an oxidative burst [6]. Here we show that tPA–/– and WT neutrophils have a similar capacity to phagocytose E. coli. Expression of L-selectin and β2-integrin—important determinants of leukocyte function—is also equal in WT and tPA–/– neutrophils (data not shown). However, upon stimulation with uropathogenic E. coli tPA–/– neutrophils display a significantly lower production of ROS than WT neutrophils, most probably resulting in higher numbers of surviving bacteria in our UTI model. Interestingly, the addition of recombinant tPA results in a complete restoration of the oxidative capacity of tPA–/– neutrophils. Previous reports on the effect of tPA on ROS production are inconsistent. In vitro administration of exogenous tPA can both enhance and reduce neutrophil ROS production upon induction by phorbol-12-myristate-13-acetate (PMA) [36,37]. Since PMA directly activates protein kinase C (PKC), thus bypassing cell surface receptors [38], these studies suggest that exogenous tPA can affect the non-receptor-mediated superoxide production cascade in vitro although its net effect remains unclear. In the present study, we use uropathogenic E. coli as a stimulus, which triggers the receptor-mediated pathway of superoxide generation.

Deficiency for uPA has been shown to result in a lower phagocytic potential of neutrophils, combined with a lower oxidative burst [39]. Upon neutrophil activation, uPA is released from intracellular vesicles into the extracellular compartment [40,41]. The uPA most probably regulates phagocytosis and ROS production through interaction with its highly specific cellular receptor uPAR, which by itself is crucially involved in neutrophil phagocytosis as well [15,39].

Activated neutrophils not only produce uPA but tPA as well, be it in smaller quantities [42–44]. Opposed to uPA, no specific tPA receptor has been described thus far. It is known that tPA can bind to the low-density LRP-1 and to annexin A2 although binding to these receptors occurs in a non-specific fashion. LRP-1 is a scavenging receptor that is crucially involved in the clearance of its numerous structurally different ligands but has the ability to act as a signalling receptor as well [45]. However, LRP-1 is not expressed by neutrophils [46], which makes it unlikely that LRP-1 is involved in the observed oxidative burst modulation.

The other tPA receptor, annexin A2, is a widely expressed cell membrane Ca2+/phospholipid-binding protein that is present on endothelial cells and on neutrophils as well [47–49]. Annexin A2 has the ability to function as a signalling receptor and has been implicated in neutrophil chemotaxis [49]. Recently, it was shown that interaction of tPA with Annexin A2 mediates activation of microglia, the immune cells of the brain, in a non-proteolytic fashion [50]. Although further research will be needed, interaction of tPA and annexin A2 on neutrophils might influence chemotaxis and possibly superoxide production.

The present study describes for the first time that endogenous tPA is critically involved in host defence during E. coli-induced pyelonephritis, most likely by affecting neutrophil migration and neutrophil oxidative burst generation. Our data extend current knowledge on host-pathogen interactions during UTI and provide new insight into the manifold effects of tPA.



   Acknowledgments
 
The authors wish to thank Mr. E. H. Laghmani for providing expert technical assistance. This study was supported by a grant from The Netherlands Organisation for Scientific Research, grant number: 015-001-061. Parts of this work were presented at the 2006 International Cytokine Society Conference, August 2006, Vienna, Austria and at the 39th Annual Meeting of the American Society of Nephrology, November 2006, San Diego, California.

Conflict of interest statement. None declared.



   Notes
 
4 Present address: Department of Radiation Oncology, Research Institute Growth and Development, University of Maastricht, Maastricht, The Netherlands. Back



   References
Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 

  1. Barnett BJ, Stephens DS. Urinary tract infection: an overview. Am J Med Sci (1997) 314:245–249.[CrossRef][Web of Science][Medline]
  2. Webb NJ, Brenchley PE. Cytokines and cell adhesion molecules in the inflammatory response during acute pyelonephritis. Nephron Exp Nephrol (2004) 96:e1–e6.[CrossRef][Medline]
  3. Cotton SA, Gbadegesin RA, Williams S, et al. Role of TGF-beta1 in renal parenchymal scarring following childhood urinary tract infection. Kidney Int (2002) 61:61–67.[Web of Science][Medline]
  4. Johnson JR. Virulence factors in Escherichia coli urinary tract infection. Clin Microbiol Rev (1991) 4:80–128.[Abstract/Free Full Text]
  5. Ganz T. Defensins: antimicrobial peptides of innate immunity. Nat Rev Immunol (2003) 3:710–720.[CrossRef][Web of Science][Medline]
  6. Mulvey MA, Schilling JD, Martinez JJ, et al. Bad bugs and beleaguered bladders: interplay between uropathogenic Escherichia coli and innate host defenses. Proc Natl Acad Sci USA (2000) 97:8829–8835.[Abstract/Free Full Text]
  7. Quinn MT, Gauss KA. Structure and regulation of the neutrophil respiratory burst oxidase: comparison with nonphagocyte oxidases. J Leukoc Biol (2004) 76:760–781.[Abstract/Free Full Text]
  8. Klebanoff SJ. Myeloperoxidase: friend and foe. J Leukoc Biol (2005) 77:598–625.[Abstract/Free Full Text]
  9. Collen D. The plasminogen (fibrinolytic) system. Thromb Haemost (1999) 82:259–270.[Web of Science][Medline]
  10. Sappino AP, Huarte J, Vassalli JD, et al. Sites of synthesis of urokinase and tissue-type plasminogen activators in the murine kidney. J Clin Invest (1991) 87:962–970.[Web of Science][Medline]
  11. Roelofs JJ, Rouschop KM, Leemans JC, et al. Tissue-type plasminogen activator modulates inflammatory responses and renal function in ischemia reperfusion injury. J Am Soc Nephrol (2006) 17:131–140.[Abstract/Free Full Text]
  12. Hu K, Yang J, Tanaka S, et al. Tissue-type plasminogen activator acts as a cytokine that triggers intracellular signal transduction and induces matrix metalloproteinase-9 gene expression. J Biol Chem (2006) 281:2120–2127.[Abstract/Free Full Text]
  13. Renckens R, Roelofs JJ, Florquin S, et al. Endogenous tissue-type plasminogen activator is protective during Escherichia coli-induced abdominal sepsis in mice. J Immunol (2006) 177:1189–1196.[Abstract/Free Full Text]
  14. Olszyna DP, Florquin S, Sewnath M, et al. CXC chemokine receptor 2 contributes to host defense in murine urinary tract infection. J Infect Dis (2001) 184:301–307.[CrossRef][Web of Science][Medline]
  15. Roelofs JJ, Rouschop KM, Teske GJ, et al. The urokinase plasminogen activator receptor is crucially involved in host defense during acute pyelonephritis. Kidney Int (2006) 70:1942–1947.[Web of Science][Medline]
  16. Hopkins WJ, Gendron-Fitzpatrick A, Balish E, et al. Time course and host responses to Escherichia coli urinary tract infection in genetically distinct mouse strains. Infect Immun (1998) 66:2798–2802.[Abstract/Free Full Text]
  17. Rouschop KM, Sylva M, Teske GJD, et al. Urothelial CD44 facilitates Escherichia coli infection of the murine urinary tract. J Immunol (2006) 177:7225–7232.[Abstract/Free Full Text]
  18. ter Horst SA, Wagenaar GT, de Boer E, et al. Pentoxifylline reduces fibrin deposition and prolongs survival in neonatal hyperoxic lung injury. J Appl Physiol (2004) 97:2014–2019.[Abstract/Free Full Text]
  19. Renckens R, Roelofs JJ, ter Horst SA, et al. Absence of thrombin-activatable fibrinolysis inhibitor protects against sepsis-induced liver injury in mice. J Immunol (2005) 175:6764–6771.[Abstract/Free Full Text]
  20. Hui KY, Haber E, Matsueda GR. Monoclonal antibodies to a synthetic fibrin-like peptide bind to human fibrin but not fibrinogen. Science (1983) 222:1129–1132.[Abstract/Free Full Text]
  21. Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem (1976) 72:248–254.[CrossRef][Web of Science][Medline]
  22. Stuurman N, Pacios Bras C, Schlaman HR, et al. Use of green fluorescent protein color variants expressed on stable broad-host-range vectors to visualize rhizobia interacting with plants. Mol Plant Microbe Interact (2000) 13:1163–1169.[Web of Science][Medline]
  23. Kampen AH, Tollersrud T, Lund A. Flow cytometric measurement of neutrophil respiratory burst in whole bovine blood using live Staphylococcus aureus. J Immunol Methods (2004) 289:47–55.[CrossRef][Web of Science][Medline]
  24. Florquin S, Van Den Berg JG, Olszyna DP, et al. Release of urokinase plasminogen activator receptor during urosepsis and endotoxemia. Kidney Int (2001) 59:2054–2061.[Web of Science][Medline]
  25. Kitching AR, Holdsworth SR, Ploplis VA, et al. Plasminogen and plasminogen activators protect against renal injury in crescentic glomerulonephritis. J Exp Med (1997) 185:963–968.[Abstract/Free Full Text]
  26. Bickerstaff AA, Xia D, Pelletier RP, et al. Mechanisms of graft acceptance: evidence that plasminogen activator controls donor-reactive delayed-type hypersensitivity responses in cardiac allograft acceptor mice. J Immunol (2000) 164:5132–5139.[Abstract/Free Full Text]
  27. Stringer KA, Bose SK, McCord JM. Antiinflammatory activity of tissue plasminogen activator in the carrageenan rat footpad model. Free Radic Biol Med (1997) 22:985–988.[CrossRef][Web of Science][Medline]
  28. Wang YF, Tsirka SE, Strickland S, et al. Tissue plasminogen activator (tPA) increases neuronal damage after focal cerebral ischemia in wild-type and tPA-deficient mice. Nat Med (1998) 4:228–231.[CrossRef][Web of Science][Medline]
  29. Cook AD, Braine EL, Campbell IK, et al. Differing roles for urokinase and tissue-type plasminogen activator in collagen-induced arthritis. Am J Pathol (2002) 160:917–926.[Abstract/Free Full Text]
  30. Yang YH, Carmeliet P, Hamilton JA. Tissue-type plasminogen activator deficiency exacerbates arthritis. J Immunol (2001) 167:1047–1052.[Abstract/Free Full Text]
  31. Sato J, Schorey J, Ploplis VA, et al. The fibrinolytic system in dissemination and matrix protein deposition during a mycobacterium infection. Am J Pathol (2003) 163:517–531.[Abstract/Free Full Text]
  32. Khalil A, Brauner A, Bakhiet M, et al. Cytokine gene expression during experimental Escherichia coli pyelonephritis in mice. J Urol (1997) 158:1576–1580.[CrossRef][Web of Science][Medline]
  33. Olson TS, Ley K. Chemokines and chemokine receptors in leukocyte trafficking. Am J Physiol Regul Integr Comp Physiol (2002) 283:R7–R28.[Abstract/Free Full Text]
  34. Hertig A, Rondeau E. Role of the coagulation/fibrinolysis system in fibrin-associated glomerular injury. J Am Soc Nephrol (2004) 15:844–853.[Abstract/Free Full Text]
  35. Sanchez-Pernaute O, Largo R, Calvo E, et al. A fibrin based model for rheumatoid synovitis. Ann Rheum Dis (2003) 62:1135–1138.[Abstract/Free Full Text]
  36. Stringer KA, Lindenfeld J, Repine AJ, et al. Tissue plasminogen activator (tPA) inhibits human neutrophil superoxide anion production in vitro. Inflammation (1997) 21:27–34.[CrossRef][Web of Science][Medline]
  37. Obel N, Andersen PL, Andersen HR. Preserved oxidative activity and chemotaxis of circulating neutrophils in patients with acute myocardial infarction. Eur Heart J (1993) 14:790–794.[Abstract/Free Full Text]
  38. Wolfson M, McPhail LC, Nasrallah VN, et al. Phorbol myristate acetate mediates redistribution of protein kinase C in human neutrophils: potential role in the activation of the respiratory burst enzyme. J Immunol (1985) 135:2057–2062.[Abstract]
  39. Gyetko MR, Aizenberg D, Mayo-Bond L. Urokinase-deficient and urokinase receptor-deficient mice have impaired neutrophil antimicrobial activation in vitro. J Leukoc Biol (2004) 76:648–656.[Abstract/Free Full Text]
  40. Plesner T, Ploug M, Ellis V, et al. The receptor for urokinase-type plasminogen activator and urokinase is translocated from two distinct intracellular compartments to the plasma membrane on stimulation of human neutrophils. Blood (1994) 83:808–815.[Abstract/Free Full Text]
  41. Pedersen TL, Plesner T, Horn T, et al. Subcellular distribution of urokinase and urokinase receptor in human neutrophils determined by immunoelectron microscopy. Ultrastruct Pathol (2000) 24:175–182.[CrossRef][Web of Science][Medline]
  42. Wilson EL, Francis GE. Differentiation-linked secretion of urokinase and tissue plasminogen activator by normal human hemopoietic cells. J Exp Med (1987) 165:1609–1623.[Abstract/Free Full Text]
  43. Takamiya M, Saigusa K, Kumagai R, et al. Studies on mRNA expression of tissue-type plasminogen activator in bruises for wound age estimation. Int J Legal Med (2005) 119:16–21.[CrossRef][Web of Science][Medline]
  44. Moir E, Booth NA, Bennett B, et al. Polymorphonuclear leucocytes mediate endogenous thrombus lysis via a u-PA-dependent mechanism. Br J Haematol (2001) 113:72–80.[CrossRef][Web of Science][Medline]
  45. Strickland DK, Ranganathan S. Diverse role of LDL receptor-related protein in the clearance of proteases and in signaling. J Thromb Haemost (2003) 1:1663–1670.[CrossRef][Web of Science][Medline]
  46. Moestrup SK, Gliemann J, Pallesen G. Distribution of the alpha 2-macroglobulin receptor/low density lipoprotein receptor-related protein in human tissues. Cell Tissue Res (1992) 269:375–382.[CrossRef][Web of Science][Medline]
  47. Kang HM, Choi KS, Kassam G, et al. Role of annexin II tetramer in plasminogen activation. Trends Cardiovasc Med (1999) 9:92–102.[CrossRef][Web of Science][Medline]
  48. Rescher U, Gerke V. Annexins–unique membrane binding proteins with diverse functions. J Cell Sci (2004) 117:2631–2639.[Abstract/Free Full Text]
  49. McVoy LA, Kew RR. CD44 and annexin A2 mediate the C5a chemotactic cofactor function of the vitamin D binding protein. J Immunol (2005) 175:4754–4760.[Abstract/Free Full Text]
  50. Siao CJ, Tsirka SE. Tissue plasminogen activator mediates microglial activation via its finger domain through annexin II. J Neurosci (2002) 22:3352–3358.[Abstract/Free Full Text]
Received for publication: 28.10.07
Accepted in revised form: 15. 9.08


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?



This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
24/3/801    most recent
gfn562v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Roelofs, J. J. T. H.
Right arrow Articles by Florquin, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Roelofs, J. J. T. H.
Right arrow Articles by Florquin, S.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?