NDT Advance Access published online on September 26, 2007
Nephrology Dialysis Transplantation, doi:10.1093/ndt/gfm581
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Synthesis of TNF-
by mesangial cells cultured with polymeric anionic IgA—role of MAPK and NF-
B
Department of Medicine, Queen Mary Hospital, University of Hong Kong, Pokfulam, Hong Kong
Correspondence and offprint requests to: Prof. Kar Neng Lai, Department of Medicine, University of Hong Kong, Room 409, Professorial Block, Queen Mary Hospital, Pokfulam Road, Hong Kong. Email: knlai{at}hkucc.hku.hk
| Abstract |
|---|
|
|
|---|
Background. Deposition of polymeric IgA1 (pIgA) in kidney mesangium is the hallmark of IgA nephropathy (IgAN). Current consensus is that a fraction of IgA1 molecules in the circulation of IgAN patients exhibit aberrant structures or properties that may lead to their deposition. Our previous findings suggest that the anionic property of IgA1 may play a role in mesangial IgA1 deposition in patients with IgAN. In the present study, the functional consequences of the binding of anionic polymeric IgA1 to human mesangial cells (HMCs) were investigated.
Methods. Anionic polymeric IgA1 from IgAN patients and healthy subjects was isolated by sequential jacalin affinity chromatography, size exclusion chromatography using size exclusion and MonoQ ion exchange chromatography. HMCs were cultured with purified anionic polymeric IgA1 and the release of tumour necrosis factor-
(TNF-
) and interleukin-6 (IL-6) was examined by enzyme-linked immunosorbent assay. The signalling pathways involved in anionic pIgA-mediated HMC activation were examined by immunoblotting. Standard electrophoretic mobility shift assay (EMSA) was used to further examine whether the transcriptional factor NF-
B is associated in the signalling process. To define the mechanism of TNF-
and IL-6 production, HMCs were cultured with anionic pIgA in the presence or absence of p42/p44 mitogen-activated protein kinase (MAPK) inhibitor (PD98059), NF-
B inhibitor pyrrolidine dithiocarbamate (PDTC) or NF-
B blocking permeable peptides.
Results. Compared with less anionic pIgA or monomeric IgA1 (mIgA), anionic pIgA from patient with IgAN significantly increased cell proliferation (P < 0.05) when cultured with HMC. These anionic pIgA significantly increased the synthesis of TNF-
(P < 0.05) and IL-6 (P < 0.05) in a dose and time-dependent manner. Furthermore, the increased synthesis of IL-6 and TNF-
by anionic pIgA in HMC was significantly diminished (P < 0.01) in the presence of NF-
B inhibitor pyrrolidine dithiocarbamate and NF-
B blocking permeable peptides SN50 (P < 0.01). The increased synthesis of IL-6 by anionic pIgA in HMC was reduced by inhibitor to NF-
B or p42/p44 MAPK and was abolished by the simultaneous presence of inhibitors to p42/p44 MAPK and NF-
B. The up-regulation of TNF-
was partially suppressed by inhibitor to NF-
B but not PD98059.
Conclusion. Our results suggest that polymeric anionic IgA1 could activate HMC and increase the synthesis of TNF-
and IL-6. While both the p42/p44 MAPK and NF-
B pathways are essential in regulating the anionic pIgA-induced synthesis of IL-6, TNF-
synthesis mediated by anionic pIgA is partly dependent on NF-
B.
Keywords: anionic IgA; human mesangial cell; IgA nephropathy; polymeric IgA
| Introduction |
|---|
|
|
|---|
IgA nephropathy (IgAN) is a common cause of end-stage renal failure worldwide. Deposition of polymeric IgA1 in kidney mesangium is the hallmark of IgA nephropathy (IgAN). A putative nephritogenic role of the deposited IgA has been ascribed to the structure of the IgA1 and the circulating IgA1-containing immune complexes. Human IgA1 molecules contain a highly unusual structure, the hinge region, which is located between the first and second constant region domains. The hinge region consists of serine, threonine and proline. In human IgA1, the serine and the threonine are O-linked to N-acetylgalactosamine (GalNAc). The GalNAc in turn carries galactose (Gal) through a ß1,3 linkage. Either the Gal or GalNAc can be attached with or without a sialic acid (NeuNAc, N-acetylneuraminic acid). IgA1 eluted from the biopsy in IgAN are polymeric and anionic in nature [1]. Animal experiments revealed a preferential mesangial deposition of immune complexes of anionic charge suggesting that the electrostatic charge of immune complexes is important in the mesangial binding. The deposition of pIgA1 and IgA1-containing immune complex (IgA1-IC) is associated with glomerular inflammation. We and other investigators have shown that pIgA1 and IgA1-IC activated mesangial cells to produce pro-inflammatory cytokines including IL-6, transforming growth factor-ß (TGF-ß), tumour necrosis factor-
(TNF-
), monocyte chemoattractant-protein 1 (MCP-1), interleukin-8 (IL-8) and macrophage migration inhibitory factor (MIF) [2–4].
IgA1 molecules with altered carbohydrate structure may modulate mesangial cell reactivity. Deglycosylated IgA1 enhances
vß3 integrin expression by mesangial cells [5]. Deglycosylated IgA1 also decreases mRNA expression and protein synthesis of vascular endothelial growth factors (VEGFs) in mesangial cells through up-regulation of iNOS activity [6]. Gal-deficient IgA1 is prone to self-aggregation and forms large complexes that cannot be effectively removed by the catabolic pathway [7]. In vitro study revealed that binding of aggregated or pIgA to mesangial cells in IgAN led to increased expression of NF-
B [4]. The IgA1 molecules from patients with IgAN have aberrant glycosylation. The overall charge of the aberrant IgA1 molecules is inevitably affected by increased negatively charged sialic acid in the carbohydrate side chains of the IgA1 hinge region. Recent studies have focused on the roles of aberrant glycosylated IgA1 in the pathogenesis of IgAN. The charge of IgA1 molecules may be important in the pathogenesis of the disease although receiving less attention. In the present study, we examined the effect of anionic pIgA on the production of IL-6 and TNF-
in cultured human mesangial cells. The signalling mechanisms involved were also studied.
| Methods |
|---|
|
|
|---|
Materials
Rosewell Park Memorial Institute Medium (RPMI 1640 medium) and fetal bovine serum were obtained from Life Technologies (Rockville, MD, USA). Jacalin agarose was obtained from Pierce (Rockford, IL, USA). Superose fast protein liquid chromatography (FPLC) column was obtained from Amersham Pharmacia Biotech (Uppsala, Sweden). Consumables for electrophoresis were obtained from Bio-Rad Laboratories (Hercules, CA, USA). Monoclonal mouse anti-actin was obtained from Lab Vision (Fremont, CA, USA). Antibodies to total and phosphorylated p42/p44 mitogen-activated protein kinase (MAPK), pan protein kinase C (PKC), p38-MAPK and c-Jun N-terminal kinase (JNK) were obtained from Cell Signaling Technology (Beverly, MA, USA) and secondary antibodies for immunoblotting were obtained from Dako (Carpinteria, CA, USA). All other chemicals were obtained from Sigma (St Louis, MO, USA).
Patients and controls
Thirty Chinese patients (17 males and 13 females) with a clinical and renal immuno-pathological diagnosis of primary IgAN were studied. The histological diagnosis was made at least 18 months prior to the study and their serum creatinine remained stable over the previous 12 months. Their proteinuria ranging from 0.4 to 2.6 g/day, and were between 20 and 50 years of age (mean ± SD, 29.5 ± 8.5 years). IgA nephropathy was diagnosed by the presence of predominant granular IgA deposits, mainly in the glomerular mesangium and occasionally along the peripheral capillary basement membrane by immunofluorescence studies, as well as mesangial electron dense deposits in ultrastructural examination. Systemic lupus erythematosus, Henoch–Schonlein purpura and hepatic disease were excluded by detailed clinical history, examination and negative laboratory testing for hypocomplementaemia, anti-DNA antibody or hepatitis B virus surface antigen. Their endogenous creatinine clearance was >65 ml/min/1.73 m2. Venous blood was collected from each patient at clinical quiescence (a period of no macroscopic haematuria or mucosal infection and urinary erythrocyte count <10 000/ml in un-centrifuged urine). The serum was isolated and frozen at –20°C until for isolation of IgA by a jacalin-agarose affinity column. Serum IgAl concentration was determined by nephelometry. Thirty healthy subjects (18 males and 12 females), comparable in age and race with no microscopic haematuria or proteinuria, were used as controls. Serum was similarly collected from these individuals.
Culture of human mesangial cell
Isolation and characterization of human mesangial cells were performed as previously described [8]. Glomeruli were prepared from the cortex of human cadaveric kidney judged to be unsuitable or transplantation or from the intact pole of kidneys removed for circumscribed tumour. Histological examination of these kidney samples revealed no renal pathology. Glomerular cells were grown in RPMI 1640 medium supplemented with glutamine (2 mmol/l), N-[2-hydroxyethyl]-piperazine-N'-[2-ethanesulfonic acid] (HEPES) (10 mmol/l), penicillin (50 U/ml) streptomycin (50 µg/ml) and 12% fetal calf serum in an atmosphere of 5% CO2–95% air. Mesangial cells have a stellate appearance and grow in clumps. They show a network of intracellular fibrils of myosin and they contract in the presence of 1 nmol/l of angiotensin II. Mesangial cells from a single nephrectomy sample at fourth to seventh passage were used in our experiments.
Purification of polymeric and monomeric IgA
Jacalin-binding protein (JBP) was purified using a jacalin–agarose affinity column and monomeric IgA and polymeric IgA were fractionated at room temperature by the FPLC [Pharmacia, Uppsala, Sweden] as described previously [8]. The identity of IgA after FPLC was confirmed by anti-IgA affinity chromatography and an IgA sandwich enzyme-linked immunosorbent assay (ELISA). Two pooled fractions from fractions #20 to #33 (polymeric IgA fractions) and from fractions #34 to #50 (monomeric IgA fractions) were prepared for further analysis. Polymeric IgA was high-molecular mass IgA with molecular weights between 250 and 1000 kDa containing secretory component and C3 as shown by solid-phase assays. Monomeric IgA was low-molecular mass IgA with molecular weights between 100 and 250 kDa containing neither secretory component nor C3. The content of IgG in the fraction was measured by an anti-IgG ELISA. The pooled fractions were dialysed and concentrated to 2 ml with Centriprep [Amicon, Beverly, MA, USA] and stored at –70°C until use. The purity of IgA fractions was confirmed by sodium dodecyl sulphate-polyacrylamide gel (SDS-PAGE) electrophoresis and ELISA [3].
Separation of polymeric and monomeric IgA fractions using Mono-Q ion exchange chromatography
Polymeric IgA1 or monomeric IgA1 pooled fraction was first dialysed with binding buffer (20 mM Tris–HCl, pH 8.0) before applying onto a Mono Q HR 5/5 column [8]. The column was first equilibrated with 20 ml of binding buffer and the bound IgA was eluted with 12.5 ml of elution buffer (a linear salt gradient from 0 to 1 M NaCl in 20 mM Tris–HCl, pH 8.0). Sub-fractions of 250 µl were collected throughout the elution. Fifty microlitres of the eluted sub-fractions were stored for cell lysate binding ELISA. The rest of sub-fractions eluted with 0.2–0.4M NaCl in 20 mM Tris–HCl were pooled as polymeric or monomeric IgA1 bearing less anionic charges (pIgA P1 or mIgA P1). The sub-fractions eluted with 0.4–0.55M NaCl in 20 mM Tris–HCl were pooled as polymeric or monomeric IgA bearing more anionic charges (pIgA P2 or mIgA P2). The pooled sub-fractions were dialysed and concentrated to 500 µl. IgA concentration in the pooled sub-fractions was assayed by a sandwich ELISA as described previously [19]. The endotoxin content in the IgA preparations was determined using Limulus amoebocyte lysate (LAL) assay (BioWhittaker, Walkersville, MD, USA). The endotoxin level for all IgA preparations was <1 pg/mg protein. To ensure lipopolysaccharides (LPS) is not involved in the IgA-induced cytokine release, five randomly selected pIgA P2 fractions from patients were further treated with Detoxi-Gel endotoxin removing column (Pierce). The effect of pIgA P2 preparations with or without Detoxi-Gel treatment on TNF-
or IL-6 release was compared. The pooled sub-fractions were then stored at –70°C until used.
Quantification of metabolic activity, cell proliferation, viability and apoptosis of HMC cultured with IgA preparations
The metabolic activity of HMC cultured with IgA preparations were measured by a commercial colorimetric kit (Chemicon International, Temecula, CA, USA) based on cleavage of the tetrazolium salt WST-1 [2-(4-iodophenyl)-3-(4-nitrophenyl)-5-(2,4-disulfo-phenyl)-2H-tetrazolium, monosodium salt]. Briefly, growth-arrested HMCs were seeded into 96-well plates (0.25 x 105 cells per well) before exposed to IgA preparation (50 µg/ml) for 48 h. WST-1 reagent was then added and incubated at 37°C for further 2 h. The absorbance was measured using 450 nm as the primary wavelength and 600 nm as the reference wavelength. Results were expressed as percentage changes in absorbance compared with that of the medium control (defined as HMC incubated with plain culture medium). The cytotoxic effect of IgA preparations on HMC was measured by LDH assay kit (Roche Diagnostic, Indianapolis, IN, USA) according to manufacturer protocol. Results were expressed as percentage changes in relative LDH release (absorbance ratio between LDH release and the total intracellular LDH) compared with that of the medium control. HMC proliferation was measured using BrdU incorporation assay kit (Boehringer Mannheim GmbH, Mannheim, Germany) according to manufacturer's protocol. Results were expressed as percentage changes in absorbance compared with that of the medium control. To examine whether IgA induces apoptosis in HMC, activation of caspase 3 in HMC cultured with different fractions of IgA was determined using the caspase 3 activity fluorometric immunosorbant enzyme assay kit (Roche Diagnostics) according to manufacturer's protocol and the results were expressed as fluorescence unit.
Treatment of human mesangial cells with different IgA preparations
HMC were grown to confluence, the culture medium was removed and RPMI medium containing 0.1% vol/vol FBS were added to the cells for 48 h prior to further culture experiments. The cells were exposed to IgA preparations at increasing concentrations (0, 25, 50, 100 or 200 µg/ml) for 48 h at 37°C. In order to study whether TNF-
or IL-6 synthesis by mesangial cells was associated with p42/p44 MAPK or/and NF-
B, similar experiments were performed in cells pre-incubated with inhibitors to p42/p44 MAPK (PD98059, 25 mM) or/and NF-
B before stimulating with different IgA preparations (50 µg/ml). For all experiments, the culture supernatant was collected and stored at –70°C for ELISA determination of TNF-
and IL-6.
ELISA of TNF-
and IL-6 in culture supernatants
A sandwich ELISA was performed according to the manufacturer's protocol (Bender MedSystems, Vienna, Austria) to quantitate the level of immuno-reactive TNF-
and IL-6 in cell culture supernatants. The detection sensitivity for TNF-
and IL-6 was 5 pg/ml and 1.6 pg/ml and the intra-batch coefficient of variation was ±7.8 and 6.3%, respectively.
Signalling molecules involved in HMC activated with anionic pIgA
HMC were grown to confluence in 6-well culture plate (1 x 106 cells per well). The cells were growth arrested with RPMI containing 0.1% vol/vol FBS for 48 h. After changing new medium, the cells were exposed to 50 µg/ml of IgA preparations for 30 min. At the end of incubation, cells were harvested for preparation of total cell or nuclear lysate as described subsequently.
Western blot analysis
HMC were lysed with lysis buffer containing protease inhibitor cocktails (Sigma). The cell extracts were pelleted at 150 000 g for 60 min to remove cell debris. The protein concentrations were measured by a modified Lowry method using bovine serum albumin as standard (DC protein assay kit, BioRad). Ten micrograms of total protein from the extract or immuno-precipitated pellet from 106 cells were electrophoresed through a 15% SDS-PAGE gel before transferring to a PVDF membrane. After blocking for 1 h at room temperature in blocking buffer (1% gelatin in PBS with 0.05% Tween-20), the membrane was incubated for 16 h with monoclonal anti-actin antibody (1:1000); rabbit anti-phospho p42/44 MAPK (1:5000), rabbit anti-phospho pan PKC antibody (1:4000) or rabbit anti-JNK antibody (1:1000) in PBS–Tween. The membrane was washed and incubated for 2 h at room temperature with a peroxidase-labelled goat anti-rabbit or anti-mouse immunoglobulin (Dako). After further washing, the membrane was detected with ECL chemiluminescence (Amersham Pharmacia Biotech, Arlington, IL, USA). For semi-quantitative determination of protein expression, western blotting images for some experiments were scanned on a flatbed scanner and the density of the bands was quantitated using ImageQuant software (Molecular Dynamic, Sunnyvale, CA, USA). Densitometry results were reported as percentages of medium control after normalization with the average arbitrary integrated values of the actin signal.
Electrophoretic mobility shift assay (EMSA)
Standard EMSA was used to further examine the role of the transcription factors activator protein-1 (AP-1) and NF-
B in anionic pIgA-induced HMC activation. For EMSA of NF-
B, HMCs were cultured in T75 tissue culture flask and, upon confluence, treated with different IgA preparations (50 µg/ml) for 1 h. In parallel experiment, HMCs were incubated with 25 µM PDTC (Sigma) or 100 µg/ml cell membrane-permeable peptides (SN50M or SN50) for 30 min before cultured with pIgA P2 from IgAN Patients. For EMSA of AP-1, HMCs were treated with different IgA preparations (50 µg/ml) for 1 h. In parallel experiment, HMCs were incubated with inhibitor to p42/p44 MAPK (PD98059, 25 mM) for 30 min before cultured with pIgA P2 from IgAN patients. At the end of the incubation, nuclear extract was prepared using NE-PER nuclear extraction reagent (Pierce) and stored at –70°C until assay. Gel shift oligonucleotide for NF-
B (AGTTGAGGGGACTTTCCCAGGC) or AP-1 (CGCTTGATGACTCAGCCGGAA) was biotinylated using Biotin 3' end labelling kit (Pierce) and the EMSA was carried out with the LightShift chemiluminescent EMSA kit (Pierce) according to manufacturer's instruction.
Statistics
All data (cell culture experiments) were expressed as means ± SD. Inter-group differences for continuous variables were assessed by the unpaired t-test. The IL-6/TNF-
protein synthesis in HMC following exposure to different concentrations of IgA preparations was analysed with multivariate ANOVA and Bonferroni's method was applied to control for multiple testing. All P values quoted are two-tailed and significance is defined as P < 0.05.
| Results |
|---|
|
|
|---|
Separation of IgA1 into differently charged fractions
Separation of pIgA1 or mIgA1 into two different pooled fractions (pIgA P1 and pIgA P2; mIgA P1 and mIgA P2) was carried out by ion exchange chromatography using MonoQ column and the bound IgA1 was eluted using gradient increases in ionic strength with NaCl. Figure 1 depicts the results of SDS-PAGE of the isolated pooled fractions under reducing (Figure 1A) and non-reducing condition (Figure 1B). There was no polymeric IgA co-purified with the mIgA P1 and P2 fractions and no monomeric IgA was co-purified with the pIgA P1 and pIgA P2 fractions. Under reducing SDS-PAGE, the IgA molecules in all pooled fractions were resolved to heavy and light chains of predicted molecular weight (55 and 23 kDa). The concentration of IgA1 of differently charged fractions was shown in Table 1. The IgA1 concentration in sub-fractions pIgA P1, pIgA P2 and mIgA P1 of IgAN patients was significantly higher than the comparable fractions from the control subjects (P < 0.05). There was no significant difference in the amount of mIgA P2 between the IgAN patients and controls. The amount of more anionic pIgA P2 fraction represented <5% of total purified IgA1 in IgAN patients and controls.
|
|
Proliferation of HMC cultured with anionic pIgA
Figure 2A and B depicts the metabolic activity of HMC and cell viability following incubation with different IgA preparations for 48 h determined by the WST kit and LDH assay. Polymeric IgA from patients with IgAN significantly increased the metabolic activity in HMC (P < 0.05) (Figure 2A). HMC remained viable when exposed to various IgA fractions at concentrations of 50 µg/ml (Figure 2B). Polymeric IgA from patients with IgAN significantly increased the cell proliferation in HMC (P < 0.05) as determined by BrdU incorporation assay (Figure 2C). Results of caspase 3 assay indicate that there was no apoptosis when HMCs were exposed to all IgA preparation tested (Figure 2D).
|
Effect of anionic pIgA on the synthesis of TNF-
and IL-6 by HMCGrowth arrested HMCs were cultured with IgA preparations at 50 µg/ml for 48 h. The release of TNF-
and IL-6 in HMC was determined by ELISA. Anionic pIgA (pIgA P2) from patients with IgAN significantly up-regulated TNF-
and IL-6 release in HMC (Figure 3). Less anionic pIgA fraction (pIgA P1) from IgAN patients only slightly increased the TNF-
and IL-6 synthesis in HMC and the differences were not statistically significant. Compared with other IgA preparations, the release of TNF-
by HMC cultured with anionic pIgA from patients with IgAN was significantly higher (P < 0.05). The release of IL-6 by HMC cultured with anionic pIgA from patients with IgAN was also significantly higher than other IgA preparations from IgAN patients and controls. Anionic polymeric IgA1 preparations up-regulated TNF-
and IL-6 release in a dose- and time-dependent manner (Figures 4 and 5). The up-regulatory effect of anionic pIgA preparation (pIgA P2) from patients with IgAN was significantly higher as compared with less anionic pIgA (pIgA P1) and mIgA preparations (P < 0.05). Although HMC from a single donor was used in the present study, our preliminary data had shown that pIgA P2 from patients significantly enhanced TNF and IL-6 release by HMC obtained from three other donors when compared with pIgA P2 from control subjects (data not shown). To ensure that lipopolysaccharides (LPS) is not involved in the IgA-induced TNF-
or IL-6 release, selected pIgA P2 fractions from patients were further treated with Detoxi-Gel endotoxin removing column. Detoxi-Gel treatment did not alter the levels of TNF-
or IL-6 release induced by pIgA P2 preparations (data not shown).
|
|
|
Activation of MAPK, AP-1 and NF-
B by anionic polymeric IgAWe investigated whether anionic pIgA activated the p42/p44 MAPK, PKC, JNK and p38-MAPK signalling pathways in HMC by immunoblotting studies. Anionic pIgA preparations activated p42/p44 MAPK but not PKC, JNK or p38 MAPK pathways in HMC. (Figure 6). The nuclear translocation of NF-
B in HMC after exposure to pIgA P2 was also examined by EMSA (Figure 7A). Both PDTC and SN50, but not the mutant peptide, SN50M, blocked the nuclear translocation of NF-
B. Findings from mesangial cells cultured in medium alone used as controls were shown in Figure 7B. Other additional controls including cells treated with PDTC or peptides (SN50 or SN 50M) alone or unlabelled
B oligonucleotide also revealed no shifting of the NF-
B complex by EMSA (electrophoretic gel not shown). Activation of AP-1 was observed in HMC after exposure to pIgA P2 (Figure 7C) and the activation was blocked by treatment with p42/p44 MAPK inhibitor PD98059 (Figure 7D).
|
|
Inhibition of p42/p44 MAPK or NF-
BTo examine whether anionic pIgA-induced TNF-
and IL-6 synthesis in HMC was mediated through p42/p44 MAPK or/and NF-
B-associated pathways, HMCs were treated with p42/p44 MAPK inhibitor PD98059 (25 mM), PDTC or the cell membrane-permeable peptide, SN50 (that inhibits the translocation of the active NF-
B complex into the nucleus), for 1 h before and during incubation with anionic pIgA. As depicted in Figure 8, the increased synthesis of IL-6 and TNF-
and by anionic pIgA in HMC was significantly diminished in the presence of PDTC (P < 0.01) or NF-
B blocking permeable peptides, SN50 (P < 0.01). The increased synthesis of IL-6 by anionic pIgA in HMC was reduced by inhibitor to NF-
B or p42/p44 MAPK and was abolished by the simultaneous presence of inhibitors to p42/p44 MAPK and NF-
B. The up-regulation of anionic TNF-
was only partially suppressed by inhibitor to NF-
B but not by PD98059.
|
| Discussion |
|---|
|
|
|---|
This is the first study examining the functional consequence following the binding of anionic polymeric IgA1 from patients with IgAN to human mesangial cells. The absence of messenger RNA encoding for CD89, asialoglycoprotein receptor (ASGPR) and polymeric-immunoglobulin receptor (pIgR) in cultured HMC suggests that the predominant binding of polymeric IgA1 to HMC is mediated by other novel receptors or unidentified mechanisms [9]. We had previously demonstrated that pIgA with the highest negative charge binds more to HMC and the presence of polyanion decrease the binding [8]. Our findings suggest that the anionic property of IgA may play a role in mesangial activation in patients with IgAN. Keeping with this, we had demonstrated in the present study that anionic pIgA from patients with IgAN induced significant release of IL-6 and TNF-
by cultured mesangial cells. The release of IL-6 in HMC induced by anionic pIgA was dependent on the activation of p42/p44 MAPK and NF-
B while similar release TNF-
by HMC was partly associated with NF-
B but independent of p42/p44 MAPK.
Experimental animal model of IgAN with infusion of preformed IgA immune complexes had provided evidence that circulating proinflammatory cytokines may play an aggravating role in the lesions [10]. Amongst these cytokines, TNF-
is able to induce or aggravate renal damage in glomerulonephritis. Enhancement of glomerular damage by TNF-
has been observed in various experimental models of non-IgA nephritis [11,12]. TNF-
is a primary mediator in the inflammatory process and has strong immuno-modulating properties. Reduction of proteinuria, glomerular damage, infiltration of leukocytes and expression of vascular adhesion molecules were found in TNF-
knockout mice exposed to nephrotoxic agent [11]. We had previously demonstrated that pIgA is capable of inducing MIF and TNF-
production in human mesangial cell, which may play a major pathogenic role in IgAN [2]. Induction of MIF can be partially blocked by neutralizing antibody to TNF-
, suggesting the possibility that up-regulation of MIF synthesis in human mesangial cells is mediated via an amplifying proinflammatory loop involving TNF-
. In the present study, we further documented that pIgA-mediated TNF-
production by human mesangial cell was mainly restricted to an anionic subfraction of pIgA. The increased production of TNF-
in HMC induced by anionic pIgA could play an important role in the pathogenesis of IgAN. Using in vitro culture model, we had demonstrated that TNF-
and angiotensin II (AngII) are released from glomerular mesangial cells following initial deposition of pathogenetic pIgA [13]. This is followed by proliferation of the mesangial cell and infiltration of immuno-competent cells. A cross-talk network initiated by TNF-
, AngII and other soluble factors will orchestrate interactions between infiltrating immuno-competent cells and the resident renal cells, forming a major driving force of tubulointerstitial injury.
The cytokine IL-6 is also implicated in the pathogenesis of IgAN through its role in stimulating mesangial cell proliferation and synthesis of extracellular-matrix macromolecules [14,15]. IL-6 was the most probable risk factor for the aggravation of renal damage in IgAN and urinary IL-6 activity correlate well to the diagnosis, pathology and prognosis of the IgAN [16]. Imbalance in serum proinflammatory cytokines, including over-production of IL-6, is associated with disease progression in IgAN [17]. Herein, we showed that anionic pIgA stimulate mesangial cell proliferation and activated HMC to release more IL-6 suggesting anionic pIgA could play a role in the pathogenesis in IgAN. Although TNF-
and AngII are central regulators of the inflammatory process in IgAN, the IL-6 system can further promote inflammatory events through the activation and proliferation of lymphocytes, leukocyte recruitment and the induction of the acute-phase protein response not only in mesangial area where deposition of pathogenic pIgA takes place, but also at distinct sites such as tubular interstitial area.
We next examined the signal transduction pathways involved in anionic pIgA-induced TNF-
and IL-6 synthesis by HMC. Previous study demonstrated that aggregated IgA from patients with IgAN induced release of intracellular calcium, phosphorylation of p42/p44 MAPK and mesangial cell proliferation [18]. Our present data confirm this observation and extend them by showing that anionic pIgA activated p42/p44 MAPK but not PKC, JNK or p38-MAPK pathways in HMC. Recognition sequence for the transcription factor NF-
B is present in many genes that are important in immune and inflammatory reaction. NF-
B is also the most prominent transcription factors modulating target genes in response to TNF-
. Since anionic pIgA up-regulated the production of TNF-
, we speculated that NF-
B could be involved in the signal transduction pathway of mesangial cell activation by anionic pIgA. As expected, our data showed that anionic pIgA-induced nuclear translocation of NF-
B. Using inhibitors to p42/p44 MAPK and NF-
B, we further demonstrated that the increased synthesis of IL-6 by anionic pIgA in HMC was NF-
B- and p42/p44 MAPK-dependent since the synthesis of IL-6 could only be abolished by the simultaneous presence of both inhibitors. Different signal transduction pathways are involved in regulation of IL-6 gene and various transcription factors can interact with the corresponding binding sites on IL-6 promoter to initiate IL-6 mRNA transcription. The finding that inhibitors to NF-
B only partially suppressed anionic pIgA induced-IL-6 production by HMC suggested that other signalling mechanisms are operational in controlling IL-6 production. Our data also showed that activation of p42/p44 MAPK is essential in AP-1 activation and modulating anionic pIgA induced-IL-6 production by HMC and this could be related to AP-1. Binding site for AP-1 is present in the promoter region of IL-6. AP-1 can be induced by p42/p44 MAPK through activation of the transcription factors ternary-complex factors (TCFs) that induce the transcription of FOS and JUN genes, thereby increasing the number of AP-1 complexes and activating AP-1 target genes including IL-6 [19]. This is the first report showing that the transcriptional regulation of IL-6 production in HMC by anionic pIgA is under independent control of AP-1 and NF-
B.
The up-regulation of TNF-
by anionic pIgA in HMC was partially suppressed by inhibitor to NF-
B but not by PD98059, suggesting that an alternative pathway distinct from NF-
B and p42/p44 MAPK is implicated. Similar finding had been reported in human alveolar macrophage (HAM) [20]. Incubation of HAM with pIgA resulted in enhanced TNF-
release. The activation of NF-
B in HAM by pIgA contributed partly to the up-regulation of TNF-
by pIgA. Further investigation is warranted to find out the alternative pathway involved in anionic pIgA-mediated up-regulation of TNF-
in HMC.
In conclusion, anionic pIgA from patients with IgAN can activate the p42/p44 MAPK, AP-1 and NF-
B signal transduction pathways and trigger the up-regulation of IL-6 release. Our results support that anionic pIgA-mediated-TNF-
and IL-6 release by HMC may contribute to the pathology and disease progression of IgAN.
| Acknowledgements |
|---|
|
|
|---|
The study was supported by the Research Grant Council, Hong Kong (HKU 7439/03M). JCK Leung was supported by the L & T Charitable Fund and the House of INDOCAFE.
Conflict of interest statement. None declared.
| References |
|---|
|
|
|---|
- Monteiro RC, Halbwachs-Mecarelli L, Berger J, Lesavre P. Characteristics of eluted IgA in primary IgA nephropathy. Contrib Nephrol (1984) 40:107–111.[Medline]
- Leung JC, Tang SC, Chan LY, Tsang AW, Lan HY, Lai KN. Polymeric IgA increases the synthesis of macrophage migration inhibitory factor by human mesangial cells in IgA nephropathy. Nephrol Dial Transplant (2003) 18:36–45.
[Abstract/Free Full Text] - Lai KN, Tang SC, Guh JY, et al. Polymeric IgA1 from patients with IgA nephropathy upregulates transforming growth factor-beta synthesis and signal transduction in human mesangial cells via the renin-angiotensin system. J Am Soc Nephrol (2003) 14:3127–3137.
[Abstract/Free Full Text] - Duque N, Gomez-Guerrero C, Egido J. Interaction of IgA with Fc alpha receptors of human mesangial cells activates transcription factor nuclear factor-kappa B and induces expression and synthesis of monocyte chemoattractant protein-1, IL-8, and IFN-inducible protein 10. J Immunol (1997) 159:3474–3482.[Abstract]
- Peruzzi L, Amore A, Cirina P, et al. Integrin expression and IgA nephropathy: in vitro modulation by IgA with altered glycosylation and macromolecular IgA. Kidney Int (2000) 58:2331–2340.[CrossRef][Web of Science][Medline]
- Amore A, Conti G, Cirina P, et al. Aberrantly glycosylated IgA molecules downregulate the synthesis and secretion of vascular endothelial growth factor in human mesangial cells. Am J Kidney Dis (2000) 36:1242–1252.[Web of Science][Medline]
- Hiki Y, Iwase H, Kokubo T, et al. Association of asialo-galactosyl beta 1-3N-acetylgalactosamine on the hinge with a conformational instability of Jacalin-reactive immunoglobulin A1 in immunoglobulin A nephropathy. J Am Soc Nephrol (1996) 7:955–960.[Abstract]
- Leung JC, Tang SC, Lam MF, Chan TM, Lai KN. Charge-dependent binding of polymeric IgA1 to human mesangial cells in IgA nephropathy. Kidney Int (2001) 59:277–285.[CrossRef][Web of Science][Medline]
- Leung JC, Tsang AW, Chan DT, Lai KN. Absence of CD89, polymeric immunoglobulin receptor, and asialoglycoprotein receptor on human mesangial cells. J Am Soc Nephrol (2000) 11:241–249.
[Abstract/Free Full Text] - Montinaro V, Hevey K, Aventaggiato L, et al. Extrarenal cytokines modulate the glomerular response to IgA immune complexes. Kidney Int (1992) 42:341–353.[CrossRef][Web of Science][Medline]
- Le Hir M, Haas C, Marino M, Ryffel B. Prevention of crescentic glomerulonephritis induced by anti-glomerular membrane antibody in tumor necrosis factor-deficient mice. Lab Invest (1998) 78:1625–1631.[Web of Science][Medline]
- Karkar AM, Smith J, Pusey CD. Prevention and treatment of experimental crescentic glomerulonephritis by blocking tumour necrosis factor-alpha. Nephrol Dial Transplant (2001) 16:518–524.
[Abstract/Free Full Text] - Chan LY, Leung JC, Tsang AW, Tang SC, Lai KN. Activation of tubular epithelial cells by mesangial-derived TNF-alpha: glomerulotubular communication in IgA nephropathy. Kidney Int (2005) 67:602–612.[CrossRef][Web of Science][Medline]
- Horii Y, Iwano M, Hirata E, et al. Role of interleukin-6 in the progression of mesangial proliferative glomerulonephritis. Kidney Int (1993) 39(Suppl):S71–S75.[CrossRef]
- Ruef C, Budde K, Lacy J, et al. Interleukin 6 is an autocrine growth factor for mesangial cells. Kidney Int (1990) 38:249–257.[Web of Science][Medline]
- Gordon C, Richards N, Howie AJ, et al. Urinary IL-6: a marker for mesangial proliferative glomerulonephritis? Clin Exp Immunol (1991) 86:145–149.[Web of Science][Medline]
- Rostoker G, Rymer JC, Bagnard G, Petit-Phar M, Griuncelli M, Pilatte Y. Imbalances in serum proinflammatory cytokines and their soluble receptors: a putative role in the progression of idiopathic IgA nephropathy (IgAN) and Henoch-Schonlein purpura nephritis, and a potential target of immunoglobulin therapy? Clin Exp Immunol (1998) 114:468–476.[CrossRef][Web of Science][Medline]
- Wang Y, Zhao MH, Zhang YK, Li XM, Wang HY. Binding capacity and pathophysiological effects of IgA1 from patients with IgA nephropathy on human glomerular mesangial cells. Clin Exp Immunol (2004) 136:168–175.[CrossRef][Web of Science][Medline]
- Eferl R, Wagner EF. AP-1: a double-edged sword in tumorigenesis. Nat Rev Cancer (2003) 3:859–868.[CrossRef][Web of Science][Medline]
- Ouadrhiri Y, Pilette C, Monteiro RC, Vaerman JP, Sibille Y. Effect of IgA on respiratory burst and cytokine release by human alveolar macrophages: role of ERK1/2 mitogen-activated protein kinases and NF-kappaB. Am J Respir Cell Mol Biol (2002) 26:315–332.
[Abstract/Free Full Text]
Accepted in revised form: 31. 7.07
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
A. Jacquet, H. Francois, C. Frangie, Y. Yahiaoui, S. Ferlicot, C. Micelli, X. Mariette, and A. Durrbach IgA nephropathy associated with ankylosing spondylitis is not controlled by infliximab therapy Nephrol. Dial. Transplant., November 1, 2009; 24(11): 3540 - 3542. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Xiao, J. C. K. Leung, L. Y. Y. Chan, H. Guo, and K. N. Lai Protective effect of peroxisome proliferator-activated receptor-gamma agonists on activated renal proximal tubular epithelial cells in IgA nephropathy Nephrol. Dial. Transplant., July 1, 2009; 24(7): 2067 - 2077. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. C. K. Leung, L. Y. Y. Chan, K. Y. Tam, S. C. W. Tang, M. F. Lam, A. S. Cheng, K. M. Chu, and K. N. Lai Regulation of CCN2/CTGF and related cytokines in cultured peritoneal cells under conditions simulating peritoneal dialysis Nephrol. Dial. Transplant., February 1, 2009; 24(2): 458 - 469. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||








