Skip Navigation



NDT Advance Access published online on July 19, 2007
Nephrology Dialysis Transplantation, doi:10.1093/ndt/gfm298
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
22/10/3055    most recent
gfm298v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Steinmetz, O. M.
Right arrow Articles by Wenzel, U. O.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Steinmetz, O. M.
Right arrow Articles by Wenzel, U. O.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author [2007]. Published by Oxford University Press on behalf of ERA-EDTA. All rights reserved. For Permissions, please email: journals.permissions@oxfordjournals.org

A pitfall of glomerular sieving: profibrotic and matrix proteins derive from the Bowman's capsule and not the glomerular tuft in rats with renovascular hypertension

O. M. Steinmetz1, U. Panzer1, S. Fehr2, C. Meyer-Schwesinger1, R. A. K. Stahl1 and U. O. Wenzel1

1Department of Medicine, Division of Nephrology and 2Center for Molecular Neurobiology, Department of Electron Microscopy, University Hospital Hamburg-Eppendorf, Germany

Correspondence and offprint requests to: Ulrich O. Wenzel, University Hospital of Hamburg-Eppendorf, Department of Medicine, Division of Nephrology, Martinistr. 52 20246 Hamburg, Germany. Email: wenzel{at}uke.uni-hamburg.de



   Abstract
Top
 Abstract
Introduction
 Subjects and methods
 Results
 Discussion
 Acknowledgements
 References
 
Background. The glomeruli in the non-clipped kidney of rats with 2-kidney, 1-clip hypertension are a classical model for studying the mechanisms of glomerular injury.

Methods. In the present study, we compared the glomerular expression of PAI-1 and collagen I {alpha}1 mRNA from glomeruli isolated by the classic technique of sieving with the recently developed technique of tissue laser microdissection. For quantification of mRNA from both methods, real-time PCR was used.

Results. Real-time PCR revealed a 9.0 ± 1.3- and a 7.1 ± 0.2-fold induction of PAI-1 and collagen I {alpha} 1, respectively, in the glomeruli from hypertensive rats isolated by sieving. However, in situ hybridization and microdissection revealed that expression of both mRNAs was mainly from the Bowman's capsule and not from the glomerular tuft (10.7 ± 1.3- and 7.2 ± 0.6-fold higher induction in whole glomeruli compared with tuft alone).

Conclusion. This emphasizes that studies focusing on processes in the mesangium, endothelial cells or podocytes should not rely on glomeruli obtained by sieving. Rather, a technique like the laser microdissection or in situ hybridization should be applied which allows the clear separation of different glomerular and periglomerular compartments.

Keywords: Bowman's capsule; fibrosis; glomerular sieving; glomerular tuft; microdissection; PAI-1



   Introduction
Top
 Abstract
 Introduction
Subjects and methods
 Results
 Discussion
 Acknowledgements
 References
 
The examination and quantitation of glomerular immunological and fibrotic processes occurring in experimental renal disease rely heavily on the isolation of glomeruli from the kidney. The standard method to isolate glomeruli is a sieving technique which dates back almost 50 years [1]. Over the last decades, numerous studies have been published using glomeruli isolated by this technique. Recently, mRNA analysis was facilitated by real-time PCR allowing sensitive and accurate quantitation. Not only in our laboratory but also in laboratories all over the world the obtained results from sieved glomeruli usually have been ascribed to different cellular constituents of the glomerular tuft. Here we indicate a pitfall intrinsic to this method and show that much of the data obtained in the past needs to be partly re-evaluated or at least regarded with care.



   Subjects and methods
Top
 Abstract
 Introduction
 Subjects and methods
Results
 Discussion
 Acknowledgements
 References
 
Goldblatt hypertension
Studies were performed in male Sprague–Dawley rats (Charles River, Kisslegg, Germany). In rats weighing 120–140 g, 2-kidney, 1-clip hypertension was induced as established in our group for the last 15 years [8]. For this purpose, a U-shaped silver clip (0.23–0.25 mm internal diameter) was placed around the right renal artery through a loin incision, while the animals were under isofluran anaesthesia. Rats were studied 12 weeks after surgery.

Systolic blood pressure
Systolic blood pressure was measured by tail cuff plethysmography in awake rats as described [5].

Removal of the kidney
At the end of the experimental protocol, a 21-gauge needle was inserted into the aorta above the bifurcation and was positioned under the origin of the left renal artery. The aorta above the renal artery was clamped. The vena cava was punctured and the kidney was perfused with ice-cold phosphate-buffered saline (PBS) until the kidney had blanched. The kidneys were removed and slices were fixed in 4% buffered formalin for PAS staining or frozen in Tissue Tek on dry ice for in situ hybridization.

Isolating glomeruli
The standard isolation protocol as published [4,9] was used. All steps were performed in ice-cold PBS. Kidneys were perfused with cold PBS and freshly harvested from control and Goldblatt rats. Capsules were removed and the cortex of each kidney was separated by macroscopic dissection with a sharp knife. The cortex tissue was carefully minced with the same knife on a pre-cooled glass dish in sterile PBS. The homogenized tissue was then pushed through a stainless sieve with a pore size of 90 µm by applying gentle pressure with a stencil. The sieve was rinsed several times with PBS. The tissue below the sieve, containing an enrichment of glomeruli, was collected and transferred to a sieve having a pore opening of 53 µm. After several washings with 50 ml of PBS, the material that remained on top of the sieve which contained the glomeruli was collected in 50 ml of PBS and centrifuged for 8 min at 1200 r.p.m. The supernatant was decanted while the pellet containing the glomeruli was re-suspended in PBS. The washing step was repeated two to three times until the supernatant was clear. The pore sizes of the sieves differ somewhat from older protocols [10–12] but have been chosen to ensure the best possible purity of the glomerular preparation.

Isolated glomeruli were examined by light microscopy (n = 3 for controls and hypertensive animals) to assess the percentage of glomeruli which still contained the Bowman's capsule. Two hundred glomeruli for each preparation were counted.

Preparation of total RNA from isolated rat glomeruli
Total RNA was prepared by phenol-chloroform extraction after direct lysis of the glomeruli in 4 M guanidinium thiocyanate, 25 mM sodium citrate, pH 7, 0.5% sarcosyl and 0.1 M 2-mercaptoethanol as described previously [13].

Real-time PCR
RNA preparation from laser microdissected tissues was carried out using the PALM RNA extraction kit (PALM, Bernried, Germany) according to the manufacturer's description. Real-time PCR was performed with AbiPrism NN8650 using SYBR green as dye as previously described [14]. Quantitation was performed using 18 s rRNA as an internal control to correct for small variations in RNA quantity and effectiveness of cDNA synthesis as described by AbiPrism.

The following PCR-primers were used:

PAI-1: 5'CAAGTCTGATGGTAGCACCATCTC3', 5'CCGGAGTGGTGAACTCAGTGT3'

Collagen I {alpha} 1: 5'CCGGCTCCTGCTCCTCTTA3', 5' AGGGACCCTTAGGCCATTGT3'

In situ hybridization
In situ hybridization procedures were performed as described previously [15]. The probes for rat PAI-1 and collagen I {alpha} 1 used for in situ hybridization were prepared by in vitro transcription of subcloned cDNA. The 263-bp PAI-1 probe corresponds to nucleotides 1121–1384 of sequence M24067 [GenBank] , the 298-bp collagen I {alpha} 1 probe corresponds to nucleotides 1721–2019 of sequence Z78279 [GenBank] (GenBank accession numbers).

Tissue laser microdissection
Microdissection was carried out on 8-µm thick cryosections of rat kidney tissue using the PALM MicroBeam IP 230V Z microscope for laser pressure catapulting (P.A.L.M., Bernried Germany) as described [15].

Statistical analysis
Results are expressed as means ± SD. Statistical significance was defined as P < 0.05. To compare two distinct treatment groups, we applied the Mann–Whitney U-test.

The American Physiological Society's guidelines of experimental animal research were followed and approval was obtained from the University animal care committee.



   Results
Top
 Abstract
 Introduction
 Subjects and methods
 Results
Discussion
 Acknowledgements
 References
 
Histological analysis
Light microscopy showed focal and segmental injury and thickening of Bowman's capsule in glomeruli from hypertensive rats (Figure 1A). Interestingly, thickening of the Bowman's capsule was quite consistently found, even in those glomeruli with apparently less damaged tuft architecture (Figure 1B).


Figure 1
View larger version (87K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 1. Focal and segmental glomerular scarring was found in kidneys from hypertensive rats (A). Interestingly, thickening of the Bowman's capsule was quite consistently found in many glomeruli even in those with apparently intact tuft architecture (B) (PAS staining, x200 magnification).

 
Glomerular expression of PAI-1 and collagen I {alpha} 1 mRNA from sieved glomeruli
PAI-1 and collagen I {alpha} 1 expression was increased 9.0 ± 1.3 and 7.1 ± 0.2-fold, respectively in hypertensive animals compared with controls in lysates from glomeruli obtained by sieving (Figure 2)


Figure 2
View larger version (8K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 2. Real-time PCR data analysing lysates from sieved glomeruli are shown. The mRNA expression of PAI-1 and collagen I {alpha} 1 was strongly up-regulated in hypertensive rats. n = 4 PCR reactions each containing pooled glomeruli from 2–4 rats. *P < 0.05 vs controls.

 
In situ hybridization
Next we were interested to examine the cellular source of PAI-1 and collagen I {alpha} 1 by in situ hybridization. Much to our surprise, by far the most abundant expression of both profibrotic mRNA transcripts localized to the Bowman's capsule and in contrast only very faint staining was found in the glomerular convolute (n = 3 per group) (Figure 3A and B).


Figure 3
View larger version (85K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 3. Photomicrographs from in situ hybridization of PAI-1 and collagen I {alpha} 1 are shown in Figure 3A and B (x400 magnification, Mayer's Haemalaun staining). Abundant expression localized to the Bowman's capsule and only faint staining was found in the glomerular tuft.

 
Tissue laser microdissection
Since in situ hybridzation and light microscopy are semi-quantitative methods we next applied tissue laser microdissection (LCM) to further quantify the observed changes. As shown in Figure 4A and B, glomerular sections can easily be identified and the whole glomerular section consisting of the tuft and Bowman's capsule was cut out for PCR analysis. On the other hand, it is also possible to selectively cut out the glomerular tuft alone as demonstrated in Figure 4C and D. The surprising results are shown in Figure 4E. Whole glomeruli containing the Bowman's capsule and tuft from Goldblatt animals had a 10.7 ± 1.3- and 7.2 ± 0.6-fold higher expression of PAI-1 and collagen I {alpha} 1 mRNA transcripts (n = 3 per group) compared with glomerular tufts alone from Goldblatt animals confirming the finding of the in situ hybridization. No significant differences existed between mRNA expression of PAI-1 and collagen I {alpha} 1 in whole glomeruli compared with tufts alone in control animals (n = 3 per group) (1.6 ± 0.98-fold for PAI-1, 1.8 ± 0.93-fold for collagen I {alpha} 1, whole glomeruli compared with tuft, n.s.)


Figure 4
View larger version (55K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 4. A photomicrograph of a whole glomerulus before (A) and after microdissection (B) is shown. In contrast, (C) and (D) demonstrate selective cutting of the glomerular tuft from a tissue section (x400 magnification, cresyl violet acetate staining). (E) shows the PCR data of non-clipped kidneys from n = 3 Goldblatt animals using mRNA from 50 to 70 whole glomeruli or tufts only. *P < 0.05 vs tuft. (F) demonstrates no significant difference in mRNA expression of PAI-1 and collagen I {alpha} 1 between glomerular tufts of control and Goldblatt animals (n = 3 per group).

 
We next compared the mRNA expression in the tufts of Goldblatt hypertensive rats with the tufts of control animals to find out whether PAI-1 and collagen I {alpha} 1 are up-regulated in the glomerular tuft of hypertensive animals, only maybe on a much lower level. Expression of both mRNAs was generally very weak in tufts from both groups (n = 3 per group). Comparison showed no significant differences as illustrated in Figure 4F (0.68 ± 0.23-fold for PAI-1, 1.33 ± 0.18-fold for collagen I {alpha} 1, Goldblatt compared with controls control, n.s.).

Histological analysis of sieved glomeruli
We finally went back to the glomeruli isolated by sieving. A photomicrograph of isolated glomeruli spread on a slide is shown in Figure 5. A glomerulus with (left side) and one without Bowman's capsule (right side) are clearly visible. To quantify this observation, sieved glomeruli of hypertensive animals (n = 3) and controls (n = 3) were analysed by light microscopy (n = 200 per animal). Glomeruli of 20 ± 5% from control animals and 18 ± 6.2% of glomeruli from hypertensive rats contained the Bowman's capsule. Therefore, it is obvious that all preparations of glomeruli isolated by the sieving technique contain a mixture of tissues derived from the Bowman's capsule and glomerular tuft.


Figure 5
View larger version (110K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 5. Photomicrograph of isolated glomeruli spread on a slide. A glomerulus with (left) and another one without Bowman's capsule (right) are visible (x400 magnification).

 


   Discussion
Top
 Abstract
 Introduction
 Subjects and methods
 Results
 Discussion
Acknowledgements
 References
 
The glomeruli in the non-clipped kidney of rats with 2-kidney, 1-clip hypertension are a classical model for studying glomerular injury. Over the last two decades, we and others have published several studies in this model [2–5]. This report is a technical note demonstrating that mRNA transcripts quantified from glomeruli which were isolated by the regularly applied sieving technique are not necessarily derived from the glomerular tuft. It is a well-described but often disregarded fact that all published preparations of glomeruli by sieving yield a mixture of glomeruli with and without the Bowman's capsule [10–12]. We found glomerular up-regulation of the profibrotic mediator PAI-1 and of collagen I {alpha} 1 mRNA in hypertensive rats. Much to our surprise, the cellular source of mRNA production was not to be found within the glomerular tuft as expected but was confined to the cells of the Bowman's capsule as proven by in situ hybridization and laser microdissection. In accordance with this finding, up-regulation of PAI-1 has been described before in several glomerular diseases in different compartments including the Bowman's capsule [16–21].

It is beyond the scope of the present study to elucidate in more detail the role of the Bowman's capsule in the pathogenesis of hypertensive glomerular injury. However, our study indicates that parietal epithelial cells are critically involved in the disease process. This assumption is stressed further by studies in mice and humans that have already suggested that parietal epithelial cells do contribute to matrix deposition and cellular lesions in diseases like focal segmental glomerulosclerosis [6]. We can only speculate about the stimulus for up-regulation of PAI-1 and {alpha} 1 collagen I in the cells of the Bowman's capsule or adjacent cells. Possibly, the paracrine interaction between the cells of the tuft and the Bowman's capsule plays a role. Addition of albumin to the medium stimulates profibrotic proteins in several renal cell lines [7]. Therefore, filtered albumin in the urine could stimulate profibrotic proteins. Recently, Kriz et al. put forward the concept of misdirected filtration which could stimulate the Bowman's capsule or adjacent cells from the outside.

How do our findings relate to those of other authors? It is important to emphasize that our data do not dispute all results obtained from isolated glomeruli in different models of renal injury. However, we can conclude from our data that the mRNA expression of profibrotic proteins is several folds higher in the Bowman's capsule than in the glomerular tuft in Goldblatt hypertensive rats as demonstrated by in situ hybridzation and tissue laser microdissection. This finding definitely challenges the concept that reliable results on the pathophysiology of glomerular injury can be obtained just by examining sieved glomeruli. Assessing the contamination of a glomerular preparation by measuring specific markers of Bowman's capsule tissue might be helpful. Candidate genes could be collagen IV {alpha} 1 and 2 which are preferentially expressed in the Bowman's capsule. However, these genes are unfortunately also expressed in mesangial cells and the glomerular basement membrane under various conditions and pathologies [22–25]. So far, no specific marker gene has been characterized to distinguish the glomerular tuft from the capsule. Another option to avoid contamination would be picking glomeruli that are void of a Bowman's capsule with a pipett under microscopic control from the sieved preparation. There is, in our experience, however, still a high possibility of contamination by small remaining parts of the capsule which are not always easily visible. Furthermore, adjacent tubular and periglomerular cells might be harvested and contaminate the mRNA preparation. Using LCM, these problems can easily be avoided.

The cellular origin of the observed changes, therefore, definitely has to be defined by methods like in situ hybridization or tissue laser microdissection.



   Acknowledgements
Top
 Abstract
 Introduction
 Subjects and methods
 Results
 Discussion
 Acknowledgements
References
 
We acknowledge the excellent technical assistance of Saskia Schröder, Anett Peters and Mariola Reszka.

Conflict of interest statement. None declared.



   References
Top
 Abstract
 Introduction
 Subjects and methods
 Results
 Discussion
 Acknowledgements
 References
 

  1. Cook WF, Pickering GW. A rapid method for separating glomeruli from rabbit kidney. Nature (1958) 182:1103–1104.[CrossRef][Medline]
  2. Stahl RA, Helmchen U, Paravicini M, et al. Glomerular prostaglandin formation in two-kidney, one-clip hypertensive rats. Am J Physiol (1984) 247:F975–F981.[Web of Science][Medline]
  3. Wolf G, Schneider A, Wenzel U, et al. Regulation of glomerular TGF-beta expression in the contralateral kidney of two-kidney, one-clip hypertensive rats. J Am Soc Nephrol (1998) 9:763–772.[Abstract]
  4. Wenzel UO, Wolf G, Jacob, et al. Chronic anti-Thy-1 nephritis is aggravated in the non-clipped but not in the clipped kidney of Goldblatt hypertensive rats. Kidney Int (2002) 61:2119–213.[CrossRef][Web of Science][Medline]
  5. Wenzel UO, Wolf F, Jacob I, et al. Beneficial and adverse renal and vascular effects of the vasopeptidase inhibitor omapatrilat in renovascular hypertensive rats. Nephrol Dial Transplant (2003) 18:2005–2013.[Abstract/Free Full Text]
  6. Smeets B, Te Loeke NA, Dijkman HB, et al. The parietal epithelial cell: a key player in the pathogenesis of focal segmental glomerulosclerosis in Thy-1.1 transgenic mice. J Am Soc Nephrol (2004) 15:928–939.[Abstract/Free Full Text]
  7. Wolf G, Schroeder R, Ziyadeh FN, et al. Albumin up-regulates the type II transforming growth factor-beta receptor in cultured proximal tubular cells. Kidney Int (2004) 66:1849–1858.[CrossRef][Web of Science][Medline]
  8. Wenzel UO, Helmchen U, Troschau G, et al. Adverse effect of the calcium channel blocker nitrendipine on nephrosclerosis in rats with renovascular hypertension. Hypertension (1992) 20:233–241.[Abstract/Free Full Text]
  9. Wenzel U, Schneider A, Valente AJ, et al. Monocyte chemoattractant protein-1 mediates monocyte/macrophage influx in anti-thymocyte antibody-induced glomerulonephritis. Kidney Int (1997) 51:770–776.[Web of Science][Medline]
  10. Misra RP. Isolation of glomeruli from mammalian kidneys by graded sieving. Am J Clin Pathol (1972) 58:135–113.[Web of Science][Medline]
  11. Kreisberg JI, Karnovsky MJ. Glomerular cells in culture. Kidney Int (1983) 23:439–444.[Web of Science][Medline]
  12. Yaoita E, Yamamoto T, Saito M, et al. Desmin positive cells outgrowing from rat encapsulated glomeruli. Eur J Cell Biol (1991) 54:140–149.[Web of Science][Medline]
  13. Steinmetz O, Sadaghiani S, Panzer U, et al. Antihypertensive therapy induces compartment specific chemokine expression and a Th1 immune response in the clipped kidney of Goldblatt hypertensive rats. Am J Physiol (2007) 292:F876–F887.[CrossRef][Web of Science]
  14. Panzer U, Reinking RR, Steinmetz OM, et al. CXCR3 and CCR5 positive T-cell recruitment in acute human renal allograft rejection. Transplantation (2004) 78:1341–1350.[Web of Science][Medline]
  15. Panzer U, Steinmetz OM, Reinking RR, et al. Compartment-specific expression and function of the chemokine IP-10/CXCL10 in a model of renal endothelial microvascular injury. J Am Soc Nephrol (2006) 17:454–464.[Abstract/Free Full Text]
  16. Barnes JL, Mitchell RJ, Torres ES. Expression of plasminogen activator-inhibitor-1 (PAI-1) during cellular remodeling in proliferative glomerulonephritis in the rat. J Histochem Cytochem (1995) 43:895–905.[Abstract]
  17. Grandaliano G, Gesualdo L, Ranieri E, et al. Tissue factor, plasminogen activator inhibitor-1, and thrombin receptor expression in human crescentic glomerulonephritis. Am J Kidney Dis (2000) 35:726–738.[Web of Science][Medline]
  18. Keeton M, Ahn C, Eguchi Y, et al. Expression of type 1 plasminogen activator inhibitor in renal tissue in murine lupus nephritis. Kidney Int (1995) 47:148–157.[Web of Science][Medline]
  19. Ma LJ, Nakamura S, Whitsitt JS, et al. Regression of sclerosis in aging by an angiotensin inhibition-induced decrease in PAI-1. Kidney Int (2000) 58:2425–2436.[CrossRef][Web of Science][Medline]
  20. Nakamura S, Nakamura I, Ma L, et al. Plasminogen activator inhibitor-1 expression is regulated by the angiotensin type 1 receptor in vivo. Kidney Int (2000) 58:251–259.[CrossRef][Web of Science][Medline]
  21. Yamamoto K, Loskutoff DJ. The kidneys of mice with autoimmune disease acquire a hypofibrinolytic/procoagulant state that correlates with the development of glomerulonephritis and tissue microthrombosis. Am J Pathol (1997) 151:725–734.[Abstract]
  22. Dijkman H, Smeets B, Van der Laak J, et al. The parietal epithelial cell is crucially involved in human idiopathic focal segmental glomerulosclerosis. Kidney Int (2005) 68:1562–1572.[CrossRef][Web of Science][Medline]
  23. Lei J, Silbiger S, Ziyadeh FN, Neugarten J. Serum-stimulated a1 type IV collagen gene transcription is mediated by TGF-b and inhibited by estradiol. Am J Physiol (1998) 274:F252–F258.[Web of Science][Medline]
  24. Kobayashi T, Uehara S, Ikeda T, et al. Vitamin D3 up-regulated protein-1 regulates collagen expression in mesangial cells. Kidney Int (2003) 64:1632–1642.[CrossRef][Web of Science][Medline]
  25. Smeets B, Loeke N, Dijkman H, et al. The parietal epithelial cell: a key player in the pathogenesis of focal segmental glomerulosclerosis in Thy-1.1transgenic mice. J Am Soc Nephrol (2004) 15:928–939.[Abstract/Free Full Text]
Received for publication: 16. 9.06
Accepted in revised form: 19. 4.07


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 HypertensionHome page
J. C. Q. Velez, K. J. Ryan, C. E. Harbeson, A. M. Bland, M. N. Budisavljevic, J. M. Arthur, W. R. Fitzgibbon, J. R. Raymond, and M. G. Janech
Angiotensin I Is Largely Converted to Angiotensin (1-7) and Angiotensin (2-10) by Isolated Rat Glomeruli
Hypertension, May 1, 2009; 53(5): 790 - 797.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
22/10/3055    most recent
gfm298v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Steinmetz, O. M.
Right arrow Articles by Wenzel, U. O.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Steinmetz, O. M.
Right arrow Articles by Wenzel, U. O.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?