Skip Navigation



NDT Advance Access published online on September 17, 2007

Nephrology Dialysis Transplantation, doi:10.1093/ndt/gfm244
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
22/12/3586    most recent
gfm244v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Girndt, M.
Right arrow Articles by Köhler, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Girndt, M.
Right arrow Articles by Köhler, H.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author [2007]. Published by Oxford University Press on behalf of ERA-EDTA. All rights reserved. For Permissions, please email: journals.permissions@oxfordjournals.org

Influence of cytokine gene polymorphisms on erythropoetin dose requirements in chronic haemodialysis patients

Matthias Girndt1, Peter Stenvinkel2, Christof Ulrich1, Jonas Axelsson2, Louise Nordfors2, Peter Barany2, Juan Jesus Carrero2, Gunnar H. Heine1, Harald Kaul3 and Hans Köhler1

1Medical Department IV, University of the Saarland, Homburg/Saar, Germany, 2Division of Renal Medicine, Department of Clinical Science Intervention and Technology, Karolinska University Hospital, Karolinska Institutet, Stockholm, Sweden and 3Medical Department I, Klinikum Deggendorf, Deggendorf, Germany

Correspondence and offprint requests to: Matthias Girndt, Medical Department IV, Nephrology and Hypertension Unit, University of the Saarland, D-66421 Homburg/Saar, Germany. Email: matthias.girndt{at}uks.eu



   Abstract
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 Conclusions
 Acknowledgements
 References
 
Background. Chronic inflammation influences renal anaemia and reduce erythropoetin effectiveness. Chronic kidney disease and haemodialysis (HD) induce elevated cytokine and C-reactive protein (CRP) levels at an inter-individually variable extent. These differences are in part due to polymorphisms within cytokine genes, e.g. for pro-inflammatory interleukin-6 (IL-6) and anti-inflammatory interleukin-10 (IL-10). We hypothesized that these polymorphisms influence erythropoetin effectiveness.

Methods. Genotyping for polymorphisms of IL-6 (–174G/C) and IL-10 (–1082G/A) genes was done in 460 prevalent HD patients. Erythropoetin requirements were determined after three months of stable dosing of erythropoesis stimulating proteins (ESP). The effect of the cytokine genotypes was evaluated by multiple regression analysis.

Results. The presence of the IL-6 –174G allele (found to be related with higher secretion of IL-6) was associated with a 26% higher ESP dose compared with individuals without the G allele (P = 0.008). The IL-10 –1082 G/A polymorphism was not associated with ESP needs. Multivariate analysis detected a predictive value for ESP dose of the IL-6 polymorphism (P = 0.022), the haemoglobin level and the dose of i.v. iron, but not of age, gender, dialysis vintage, ferritin or the CRP value.

Conclusions. Presence of the IL-6 allele –174G is related to higher ESP doses in chronic HD patients. The polymorphism of the anti-inflammatory IL-10 does not influence ESP dose, probably due to the fact that this cytokine has directly inhibitory effects on haematopoiesis in addition to its beneficial effects on inflammation.

Keywords: cytokines; erythropoetin; haemodialysis; inflammation; kidney failure chronic; polymorphism genetic



   Introduction
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 Conclusions
 Acknowledgements
 References
 
Anaemia in patients with chronic kidney disease (CKD) on haemodialysis (HD) is one of the most frequent and resource-consuming complications of this disease condition [1]. Insufficient production of erythropoetin due to renal insufficiency is probably the most relevant pathogenetic factor for renal anaemia, however, there is a large inter-individual variability in erythropoetin requirements to maintain the desired haemoglobin levels. Thus, additional factors contribute to impaired haematopoiesis and influence the efficacy of therapeutically applied erythropoesis stimulating proteins (ESP). Besides absolute or functional iron deficiency and the lack of vitamins such as folic acid or vitamin B12, chronic inflammation contributes to decreased erythropoetin effectiveness [2,3]. Chronic inflammation leads to clinically relevant anaemia in many other conditions such as rheumatic diseases or chronic inflammatory bowel disease (IBD) [4]. Pro-inflammatory cytokines act on haematopoiesis by reducing iron availability or inhibiting the maturation of erythroid precursor cells in the bone marrow.

Chronic inflammation is a common feature of many HD patients [5]. Elevated levels of C-reactive protein (CRP) are found in a majority of these individuals [6,7] and the list of endogenous or exogenous factors that induce this inflammation is growing. Among them are the reduced excretion of immunoactive proteins by the kidneys and the dialysis procedure itself. The production of CRP is induced by several cytokines with pro-inflammatory effects, among them most prominently interleukin-6 (IL-6), a mediator that is secreted by monocytes, macrophages and lymphocytes. High serum levels of IL-6 are found in the majority of chronic HD patients [8]. Elevated CRP and cytokine levels are correlated with reduced erythropoetin efficacy and elevated ESP-dose requirements in these patients [3]. Moreover, elevated pro-inflammatory markers are also associated with adverse outcome in dialysis patients with respect to immune function [9] or cardiovascular mortality [7]. The use of ultrapure dialysate as one possible intervention to reduce chronic inflammation in dialysis patients leads to improved ESP efficacy [10].

Pro-inflammatory cytokines are counter-regulated by the anti-inflammatory mediator interleukin-10 (IL-10). A higher production of this cytokine in dialysis patients is associated with lower risk of immune failure [11] and mortality [12]. The individual secretion of IL-6 and IL-10 upon a definite stimulus is relevantly influenced by polymorphisms within the promotors of the genes for these proteins. This may be an explanation for the high inter-individual variability of the inflammatory niveau in patients with the same extent of renal insufficiency or the same kind of renal replacement therapy. On this background, we hypothesized that carriers of the IL-6 –174 G allele who are more prone for an inflammatory reaction should have enhanced ESP dose requirements. Moreover, carriers of the IL-10 –1082 G allele who produce enhanced amounts of the anti-inflammatory cytokine IL-10 might need lower therapeutic ESP doses.



   Methods
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 Conclusions
 Acknowledgements
 References
 
Patients
This study included patients with end-stage renal disease on HD from three dialysis centres [Medical Department IV, University Hospital of Homburg/Saar and centre for home dialysis, Homburg/Saar Germany (n = 228); Division of Renal Medicine, Karolinska University Hospital Huddinge, Sweden (n = 213); and Klinikum Deggendorf, Germany (n = 19)]. From these institutions all patients were included who fulfilled the following criteria: chronic HD treatment for >3 months, at least 18 years of age, no malignant disease or obvious infection, no severe iron depletion as defined by a serum ferritin of at least 30 ng/ml, stable haemoglobin >9.0 g/dl, no blood transfusions within 3 months before inclusion, informed consent to participation in the genotyping study. The study identified 494 individuals, 34 had to be excluded since they did not meet inclusion criteria. Thus, 460 patients were analysed, all had a Caucasian ethnicity.

Evaluation of ESP dose requirement
Blood counts and routine chemistry in all patients were done at monthly intervals from heparinized blood drawn before a dialysis session. The patients were treated to meet the recommendations of the European Best Practice Guidelines (EBPG) for the treatment of renal anaemia [13]. The haemoglobin was targeted at 11–12 g/dl, serum ferritin was targeted at 100–500 ng/ml. Anaemia therapy was defined as being stable when ESP and iron dose had not been changed within three months. The ESP and iron preparations and doses were chosen at the discretion of the physicians of the dialysis centres and were not influenced by the study but only recorded for evaluation. In a small pilot study including 10 patients, we found that the application of an interventional algorithm for the ESP dose led to only marginal differences in the final dose compared with the mere following of physician-guided therapy. In this pilot study, haemoglobin was evaluated biweekly over 8 weeks and the dose of epoetin beta was modified after each haemoglobin measurement. When the haemoglobin level was <10.0 g/dl; the epoetin dose was increased by 1000 U thrice weekly; when the level was between 10.0 and 13.0 g/dl, epoetin dose was kept constant, at a haemoglobin above 13.0 g/dl, epoetin was reduced by 1000 U thrice weekly. Using this procedure, haemoglobin levels changed from 11.6 ± 1.4 g/dl to 11.3 ± 0.9 g/dl at 8 weeks. The epoetin dose changed from 110.6 ± 48.6 U/kg to 108.3 ± 64.3 U/kg weekly at 8 weeks. Given these insignificant changes and the relevant effort associated with this approach we decided to obtain ESP doses as prescribed by the physician in charge for the main study without a particular protocol for ESP dosing.

Genotyping
The genotyping procedure differed between the Homburg and the Stockholm centre (all German specimens were processed at Homburg). At both institutions, DNA was extracted from venous blood anti-coagulated with EDTA using the QIAamp DNA Blood Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer's protocol.

At Homburg, the single nucleotide polymorphisms were analysed by sequence-specific polymerase chain reaction (PCR) using previously published protocols and primers for the G/C polymorphism at position –174 of the IL-6 gene [14] and the G/A polymorphism at position –1082 of the IL-10 gene [15]. The IL-6 protocol uses allele-specific primers of different lengths leading to either a 121 bp (G present) or a 136 bp (C present) PCR product. For IL-10, the primers end at 3’ with the complementary base for the single polymorphic base in the promoter sequence. Thus, a PCR product in the reaction with the G- or A-specific primer is only synthesized if either G or A is present in the DNA specimen. Each reaction was controlled by amplification of a reference specimen from a patient heterozygous for the respective polymorphism. We used a Hybaid PCR Express thermocycler (Hybaid Ldt, Teddington, UK) and the Qiagen HotStarTaq Polymerase (Qiagen, Hilden, Germany). Each 25 µl reaction contained 2 µl DNA solution (20–50 ng DNA), 0.8 U HotStarTaq Polymerase, 3.5 mM MgCl2, 200 µM dATP, dGTP, dCTP and dTTP and 0.2 µM (IL-6) or 1.0 µM (IL-10) of each of the primers. Thermocycling was done with the following cycler programs: IL-6: activation of polymerase 95°C 15 min, thereafter 35 cycles 95°C 30 s denaturation, 61°C 40 s annealing and 72° 45 s elongation, finally once 72°C 5 min elongation; IL-10: activation of polymerase 95°C 15 min, thereafter 30 cycles 95°C 1 min denaturation, 64°C 105 s annealing and elongation, finally once 72°C 5 min elongation.

At Stockholm, genotyping was done by the PyrosequencingTM method. Sequence amplification of the IL-6 and IL-10 polymorphisms was performed by the PCR on a PTC-225 Thermocycler (MJ Research Inc., Cambridge, MA, USA) using the following primers: IL-6 PCR primer forward 5'-3': GCCTCAATGACGACCTAAGC; PCR primer reverse 5'-3': GGCAGAATGAGCCTCAGACA; Sequencing primer 5'-3': AATGTGACGTCCTTTAGCAT. IL-10 PCR primer forward 5'-3': CCAGGTAGAGCAACACT; PCR primer reverse 5'-3': CATGGAGGCTGGATAGGA; sequencing primer 5'-3': CTTACCTATCCCTACTTCCCC. The forward PCR primer was biotinylated. The PCR reaction volume was 50 µl, containing 20–50 ng of DNA, 10 pmol of each forward and reverse primer, 200 µM of each dNTP, 0.3 U of DyNAzymeTM II (DNA Polymerase, Finnzymes, CA, USA), 10 mM of Tris–HCl, 1.5 mM of MgCl2, 50 mM of KCl and 0.1% Triton X-100. The sequencing primers were placed adjacent to the single nucleotide polymorphisms (SNPs) and the pyrosequencing reaction was performed on a PSQTM96MA Instrument from Biotage AB (Uppsala, Sweden) as described previously [16]. All oligonucleotides were synthesized by Thermo Electron Corporation (Waltham, MA, USA).

Statistics
Data management and statistical evaluation were done with the SPSS V 13.0 software (SPSS Inc, Chicago, IL, USA) and the Prism V 4.03 software (Graphpad, San Diego, CA, USA). All continuous data are presented as median ± range and were compared by the non-parametric Mann–Whitney test or the Kruskal–Wallis test as appropriate. Gene frequencies were tested for Hardy–Weinberg equilibrium using the Chi-square test. To evaluate potential factors of influence on ESP dose, a multivariate linear regression analysis was performed. In general, the null hypothesis was abandoned at an error probability of P < 0.05.



   Results
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 Conclusions
 Acknowledgements
 References
 
The study included 460 chronic HD patients from three centres, two from Germany and one from Sweden. The basic demographic data are presented in Table 1. Patients were stratified according to the presence or absence of the G allele at position –174 of the IL-6 gene and the G allele at position –1082 of the IL-10 gene. This is justified by earlier studies showing that for both cytokines the absence of G corresponds to low production of the protein [17,11]. All analyses were also performed stratifying according to the full SNP results (e.g. G/G, G/A, or A/A for IL-10). However, since this splits the patients into nine groups, no significant result could be reached (data not shown). The distributions of the full and condensed IL-6 and IL-10 genotypes are shown in Tables 2 and 3. Both cytokine genotypes were in a Hardy–Weinberg equilibrium (Chi-square test for equilibrium, P < 0.05 for both genotypes). There were no significant differences in the genotype frequencies between Swedish and German patients which matches earlier findings that German and Swedish patients do not differ in the prevalence of inflammation [6]. The relative frequency of the IL-6 G+ genotype was 0.82 in Germany and 0.77 in Sweden (P = 0.11, chi2 test), the frequency of the IL-10 G+ genotype was 0.66 in Germany and 0.67 in Sweden (P = 0.80).


View this table:
[in this window]
[in a new window]

 
Table 1. Basic demographic data of the prevalent HD patients

 

View this table:
[in this window]
[in a new window]

 
Table 2. Distribution of the IL-6 and IL-10 genotypes among the patients. Homo- and heterozygous patients for the G allele at position –174 of the IL-6 gene produce higher amounts of the cytokine compared with those homozygous for C [17]. Presence of the G allele at position –1082 of the IL-10 gene results in higher production of the cytokine compared with homozygous A [11]

 

View this table:
[in this window]
[in a new window]

 
Table 3. Distribution of the IL-6 and IL-10 genotypes among the patients. Prevalence of the full genotypes in the German and Swedish individuals. For both subpopulations, the genotypes for IL-6 and IL-6 were in a Hardy–Weinberg equilibrium (deviation from H–W equilibrium to be assumed with {chi}2 > 3.84)

 
The average haemoglobin as well as ferritin levels were not different between carriers of the different genotypes. In addition, there were no differences in age, dialysis vintage, weight, total protein or the weekly dose of iron (Tables 4 and 5).


View this table:
[in this window]
[in a new window]

 
Table 4. Comparison of patients with and without the IL-6 –174 G allele [data are median (range) P: comparison by Mann–Whitney test]

 

View this table:
[in this window]
[in a new window]

 
Table 5. Comparison of patients with and without the IL-10 –1082G allele [data are median (range); P: comparison by Mann–Whitney test]

 
Most of the patients were treated with epoetin {alpha} or ß (n = 396) while 33 patients received darbepoetin alfa and 31 (6.7%) were not substituted with ESP at all. The darbepoetin alfa dose per week was converted by multiplication with 200 for comparison. After this conversion, the average doses were not different between those individuals receiving epoetin [109.8 (11–583) IU/kg weekly] and darbepoetin alfa [116.3 (44–459) IU/kg weekly, P = 0.958]. Therefore, the patients on the different ESP were analysed together. Since the conversion factor of 200 between both ESP is based on protein mass but its bioequivalence is still controversial, we varied the factor between 160 and 240 and found that the overall results (significant difference between genotype groups as in Figure 1) remained unchanged.


Figure 1
View larger version (13K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 1. ESP doses in patients stratified according to the presence (G+, high cytokine production) or absence (G–, low production) of the G allele at position –174 of the IL-6 gene and –1082 of the IL-10 gene (mean ± SD). Patients with the ‘high-producer’ allele in both genes had a significantly higher ESP dose than those with the ‘low-producer’ alleles. *P < 0.05.

 
There was no relation between the IL-6 and IL-10 alleles and the number of patients without ESP substitution. When analysing the effects of the IL-6 and IL-10 genotypes alone on ESP doses, only the IL-6 genotype was associated with a significant difference. Individuals without the IL-6 G allele (G–) showed a lower median ESP dose than those carrying the G allele [G–: 81.6 (0–483) U/kg vs G+: 113.5 [(0–583) U/kg, P = 0.0081)]. There were no such differences in ESP use between patients with different IL-10 genotypes [G–: 92.0 (0–400) vs G+: 106.6 (0–583), P = 0.123]. Figure 1 depicts the ESP doses per week in all patients stratified according to both the IL-6 and the IL-10 genotype. There was a large variation of substitution doses and a broad overlap between the allele groups for both cytokines, however, a significant difference was found between the patients with the alleles for both genes that have been associated with low than those associated with high cytokine production in earlier studies (Figure 1).

Table 6 shows results from a multivariate analysis including age, gender, dialysis vintage, ferritin, CRP and iron supplementation as well as the IL-6 and IL-10 polymorphisms. The ESP requirements were predicted by the supplementation of iron (higher ESP dose with higher iron supplements) and the IL-6 allele at position –174. All other parameters in this analysis including the IL-10 genotype were not significantly related to the ESP dose. This is also true for CRP, which showed a tendency (P = 0.087) but did not significantly correlate with ESP dose in univariate or multivariate analysis. When stratifying patients above and below the median for CRP (7.5 mg/l), those above the median tended to have higher ESP doses [113.2 (0–583) U/kg weekly vs 94.5 (0–526) U/kg, P = 0.10]). It is important to note that we did not see a relation between CRP as a commonly used marker of inflammation and the iron supplementation dose (data not shown).


View this table:
[in this window]
[in a new window]

 
Table 6. Multiple linear regression analysis with ESP dose as the dependent variable. Only the application of iron, and the IL-6 polymorphism (presence of –174G vs not) were significant predictors of the ESP dose, gender and CRP only showed a tendency to influence it. ß is the partial regression coefficient for the variable, t is the value of the t statistics, significance printed bold if < 0.05.

 


   Discussion
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 Conclusions
 Acknowledgements
 References
 
There is a relation between inflammation in patients on chronic HD therapy and ESP requirements, although this relation is not as tight as might have been expected. We could show a predictive effect of the IL-6 –174 polymorphism with higher ESP requirements in patients carrying the –174 G allele. In earlier studies, the homozygous or heterozygous presence of the –174 G allele was responsible for a 60% increase in production of the cytokine in comparison with individuals homozygous for the C allele [17]. It should be noted that not all authors have confirmed this association between genotype and phenotype. A recent study found a reverse relationship with higher IL-6 levels in individuals with the C allele [18]. It is likely, although not proven, that ethnic differences not only result in different genotype frequencies but alter the genotype–phenotype relation, in particular since there are additional genetic variations that influence the production of IL-6 [18]. We are, to the best of our knowledge, the first to demonstrate a relation between a cytokine genotype and ESP needs in CKD. A previous study in 112 patients on peritoneal dialysis failed to show a relation between the IL-6 genotype and ESP dose, probably due to the lower number of individuals [19].

In contrast to the IL-6 findings, no clear relation could be demonstrated for the anti-inflammatory IL-10 polymorphism which is responsible for a 30% difference in secretion of this cytokine [11]. However, at least a trend could be noted that the presence of the –1082 G allele in the IL-10 gene also contributes to increasing ESP needs.

Inflammation is an important pathogenetic factor of renal anaemia. In CKD patients at all stages, elevated levels of CRP or pro-inflammatory cytokines indicate the presence of a chronic systemic inflammation [20]. Earlier studies showed that there is a relationship between markers of inflammation and the required ESP dose to maintain the desired haemoglobin levels. One of these markers is the CRP, which has become broadly accepted for the systemic inflammatory reaction in dialysis patients. Two earlier studies found a correlation between CRP and the ESP dose [21,22], although with a very high variability of CRP. In the larger of these studies by Gunnell et al. [22], CRP was no longer an independent predictor of ESP dose after the introduction of serum albumin into the multivariate analysis. This strongly indicates that the inflammatory aspects of the pathogenesis of renal anaemia are part of the malnutrition–inflammation–atherosclerosis complex (MIA-syndrome [23]). Recently, a multiple regression analysis in 677 Italian patients by Locatelli et al. [2] showed that albumin, CRP and serum iron were predictive of the weekly ESP dose. In the present study, we could not confirm a linear relation between CRP and ESP dose (although there was a tendency). This may be related to the fact that compared with the study by Gunnell et al., our patients were older (64 ± 14 vs 53 ± 18 years), had a different ethnic background and the average level of CRP was higher. Taken together, as the relation between CRP and ESP use was within the same order of magnitude, our data fit well with those reported by Locatelli et al. [2]. Also other studies have related the ESP dose to pro-inflammatory cytokines in plasma such as IL-6 [24] or tumour necrosis factor-{alpha} (TNF-{alpha}) [25] and confirmed a role for these factors, however, also with a very large inter-individual variation.

Pro-inflammatory cytokines interact with haematopoiesis at various stages. The most important effects involve the availability of iron for haeme synthesis. IL-6 induces the hepatic synthesis of the proteins hepcidin and ferritin [26]. Hepcidin limits the intestinal resorption of iron and iron export from macrophages; ferritin binds iron for storage within the reticuloendothelial system. Other inflammatory cytokines such as IL-1 or TNF-{alpha} inhibit proliferation and maturation of erythroid precursor cells within the bone marrow [4]. TNF-{alpha} also stimulates the phagocytosis of erythrocytes by macrophages, interferons induce macrophage iron uptake and reduce iron export by this cell type. Anaemia is a well-known complication of several chronic and acute inflammatory processes in patients with normal renal function [4]. Inflammation of chronic renal disease under the influence of genetic polymorphisms of cytokine genes such as IL-6 is a relevant factor for renal anaemia as well. In our study, the IL-6 –174 G allele was responsible for a 26% increment in ESP requirement. Nevertheless, there are many other conditions that influence the response of an individual patient to ESP.

IL-10 counter-regulates the inflammatory response and limits the production of all types of pro-inflammatory cytokines by monocytes and macrophages [27]. The SNP at position –1082 of the gene influences production of this protein in a clinically relevant extent. Carriers of the high-producer genotype have a lower cardiovascular mortality than low-producers, probably due to a limited chronic inflammatory activation [12]. In contrast to expectations, this polymorphism did not predict ESP response in our study, the IL-10 –1082 G allele was even associated with higher ESP doses. This most likely relates to the fact that IL-10 has several direct effects on haematopoiesis in addition to its anti-inflammatory properties. Studies on the therapeutic application of the cytokine in chronic IBD revealed the induction of anaemia as a relevant side effect. IL-10 induces the expression of transferrin receptors on macrophages and the hepatic synthesis of ferritin [28]. Both mechanisms reduce iron availability for haematopoiesis. Thus, in spite of acting against the pro-inflammatory cytokines, IL-10 is not a protein that may improve erythropoetin resistance in HD patients.

In the present study, we did not observe any difference in CRP levels between patients with the different IL-6 or IL-10 genotypes. This may indicate that the relationship between the cytokine genotypes and the systemic inflammatory level is complex and influenced by several exogenous factors. In contrast, effects of the genetic polymorphisms may act locally, e.g. within the bone marrow during maturation of erythroid progenitors. While this remains speculative at present, it is important to note that the ESP dose was not predicted by serum ferritin in our patients since patients with insufficient iron supply were excluded. Furthermore, iron supplementation and iron dose were not related to CRP. The patients received iron intravenously at an average dose of around 100 mg per week and this does not seem to have contributed relevantly to inflammation.

Study limitations
This study did not prospectively influence ESP therapy by a specific algorithm. Although this is a limitation, the ESP doses prescribed by the individual physicians while aiming at the EBPG goals for anaemia therapy reflect the actual situation of patients and probably do not deviate very far from study-driven therapy. The patients were rather old and had a very long dialysis vintage. CRP levels were only tested once, although there is a considerable variability over time. Earlier studies have shown, however, that even a single CRP determination is of prognostic value for the HD patient [7]. Furthermore, the majority were treated at tertiary centres since they had numerous comorbid conditions. The entire inflammatory level as well as the average ESP doses might be lower in other dialysis entres. This, however, does not limit the general findings of this study.



   Conclusions
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 Conclusions
 Acknowledgements
 References
 
The SNP at position –174 of the IL-6 gene has a demonstrable, although minor, influence on the ESP requirements of prevalent HD patients. Most likely, this polymorphism acts via the predisposition to a higher level of inflammation, which is associated with reduced erythropoetin efficacy. In contrast, the polymorphism of the cytokine IL-10 which acts against systemic inflammation is not predictive for ESP needs. This may be due to a direct inhibitory effect of IL-10 on haematopoiesis which interacts with the potentially beneficial action of the cytokine against inflammation.



   Acknowledgements
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 Conclusions
 Acknowledgements
 References
 
The authors wish to thank Mrs Martina Wagner and Mrs Daniela Sossong for their expert technical assistance. This work was supported by an institutional grant of the University of the Saarland and an unrestricted scientific grant by AMGEN AB, Stockholm, Sweden. J.J.C. is supported by a Fellowship from the European Renal Association European Dialysis and Transplantation Association (ERA-EDTA).

Conflict of interest statement. None declared.



   References
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 Conclusions
 Acknowledgements
 References
 

  1. U.S.Renal Data System. USRDS 2005 Annual Data Report: Atlas of End-Stage Renal Disease in the United States. Bethesda, MD: National Institutes of Health, National Institute of Diabetes and Digestive and Kidney Diseases.
  2. Locatelli F, Andrulli S, Memoli B, et al. Nutritional-inflammation status and resistance to erythropoietin therapy in haemodialysis patients. Nephrol Dial Transplant (2006) 21:991–998.[Abstract/Free Full Text]
  3. Stenvinkel P, Barany P. Anaemia, rHuEPO resistance, and cardiovascular disease in end-stage renal failure; links to inflammation and oxidative stress. Nephrol Dial Transplant (2002) 17(Suppl 5):32–37.[Abstract]
  4. Weiss G, Goodnough LT. Anemia of chronic disease. N Engl J Med (2005) 352:1011–1023.[Free Full Text]
  5. Stenvinkel P, Ketteler M, Johnson RJ, et al. IL-10, IL-6, and TNF-alpha: central factors in the altered cytokine network of uremia–the good, the bad, and the ugly. Kidney Int (2005) 67:1216–1233.[CrossRef][Web of Science][Medline]
  6. Stenvinkel P, Wanner C, Metzger T, et al. Inflammation and outcome in end-stage renal failure: does female gender constitute a survival advantage? Kidney Int (2002) 62:1791–1798.[CrossRef][Web of Science][Medline]
  7. Zimmermann J, Herrlinger S, Pruy A, Metzger T, Wanner C. Inflammation enhances cardiovascular risk and mortality in hemodialysis patients. Kidney Int (1999) 55:648–658.[CrossRef][Web of Science][Medline]
  8. Bologa RM, Levine DM, Parker TS, et al. Interleukin-6 predicts hypoalbuminemia, hypocholesterolemia, and mortality in hemodialysis patients. Am J Kidney Dis (1998) 32:107–114.[Web of Science][Medline]
  9. Girndt M, Sester U, Kaul H, Köhler H. Production of proinflammatory and regulatory monokines in hemodialysis patients shown at a single cell level. J Am Soc Nephrol (1998) 9:1689–1696.[Abstract]
  10. Hsu PY, Lin CL, Yu CC, et al. Ultrapure dialysate improves iron utilization and erythropoietin response in chronic hemodialysis patients—a prospective cross-over study. J Nephrol (2004) 17:693–700.[Web of Science][Medline]
  11. Girndt M, Sester U, Sester M, et al. The interleukin-10 promotor genotype determines clinical immune function in hemodialysis patients. Kidney Int (2001) 60:2385–2391.[CrossRef][Web of Science][Medline]
  12. Girndt M, Kaul H, Sester U, et al. Anti-inflammatory interleukin-10 genotype protects dialysis patients from cardiovascular events. Kidney Int (2002) 62:949–955.[CrossRef][Web of Science][Medline]
  13. Locatelli F, Aljama P, Barany P, et al. Revised European best practice guidelines for the management of anaemia in patients with chronic renal failure. Nephrol Dial Transplant (2004) 19(Suppl 2):1–47.[Free Full Text]
  14. Schluter B, Raufhake C, Erren M, et al. Effect of the interleukin-6 promoter polymorphism (–174 G/C) on the incidence and outcome of sepsis. Crit Care Med (2002) 30:32–37.[CrossRef][Web of Science][Medline]
  15. Perrey C, Turner SJ, Pravica V, Howell WM, Hutchinson IV. ARMS-PCR methodologies to determine IL-10, TNF-alpha, TNF-beta and TGF-beta 1 gene polymorphisms. Transpl Immunol (1999) 7:127–128.[CrossRef][Web of Science][Medline]
  16. Nordfors L, Jansson M, Sandberg G, et al. Large-scale genotyping of single nucleotide polymorphisms by Pyrosequencing TM and validation against the 5’nuclease (Taqman((R))) assay. Hum Mutat (2002) 19:395–401.[CrossRef][Web of Science][Medline]
  17. Fishman D, Faulds G, Jeffery R, et al. The effect of novel polymorphisms in the interleukin-6 (IL-6) gene on IL-6 transcription and plasma IL-6 levels, and an association with systemic-onset juvenile chronic arthritis. J Clin Invest (1998) 102:1369–1376.[Web of Science][Medline]
  18. Liu Y, Berthier-Schaad Y, Fallin MD, et al. IL-6 haplotypes, inflammation, and risk for cardiovascular disease in a multiethnic dialysis cohort. J Am Soc Nephrol (2006) 17:863–870.[Abstract/Free Full Text]
  19. Sharples EJ, Varagunam M, Sinnott PJ, McCloskey DJ, Raftery MJ, Yaqoob MM. The effect of proinflammatory cytokine gene and angiotensin-converting enzyme polymorphisms on erythropoietin requirements in patients on continuous ambulatory peritoneal dialysis. Perit Dial Int (2006) 26:64–68.[Abstract/Free Full Text]
  20. Honda H, Qureshi AR, Heimburger O, et al. Serum albumin, C-reactive protein, interleukin 6, and fetuin a as predictors of malnutrition, cardiovascular disease, and mortality in patients with ESRD. Am J Kidney Dis (2006) 47:139–148.[CrossRef][Web of Science][Medline]
  21. Barany P, Divino-Filho JC, Bergstrom J. High C-reactive protein is a strong predictor of resistance to erythropoietin in hemodialysis patients. Am J Kidney Dis (1997) 29:565–568.[Web of Science][Medline]
  22. Gunnell J, Yeun JY, Depner TA, Kaysen GA. Acute-phase response predicts erythropoietin resistance in hemodialysis and peritoneal dialysis patients. Am J Kidney Dis (1999) 33:63–72.[Web of Science][Medline]
  23. Stenvinkel P, Heimbürger O, Paultre F, et al. Strong association between malnutrition, inflammation, and atherosclerosis in chronic renal failure. Kidney Int (1999) 55:1899–1911.[CrossRef][Web of Science][Medline]
  24. Kalantar-Zadeh K, McAllister CJ, Lehn RS, Lee GH, Nissenson AR, Kopple JD. Effect of malnutrition-inflammation complex syndrome on EPO hyporesponsiveness in maintenance hemodialysis patients. Am J Kidney Dis (2003) 42:761–773.[CrossRef][Web of Science][Medline]
  25. Goicoechea M, Martin J, de-Sequera P, et al. Role of cytokines in the response to erythropoietin in hemodialysis patients. Kidney Int (1998) 54:1337–1343.[CrossRef][Web of Science][Medline]
  26. Nemeth E, Rivera S, Gabayan V, et al. IL-6 mediates hypoferremia of inflammation by inducing the synthesis of the iron regulatory hormone hepcidin. J Clin Invest (2004) 113:1271–1276.[CrossRef][Web of Science][Medline]
  27. Fiorentino DF, Zlotnik A, Mosmann TR, Howard M, O’Garra A. IL-10 inhibits cytokine production by activated macrophages. J Immunol (1991) 147:3815–3822.[Abstract]
  28. Tilg H, Ulmer H, Kaser A, Weiss G. Role of IL-10 for induction of anemia during inflammation. J Immunol (2002) 169:2204–2209.[Abstract/Free Full Text]
Received for publication: 2. 1.07
Accepted in revised form: 30. 3.07


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
NDT PlusHome page
A. L. M. de Francisco, P. Stenvinkel, and S. Vaulont
Inflammation and its impact on anaemia in chronic kidney disease: from haemoglobin variability to hyporesponsiveness
NDT Plus, January 1, 2009; 2(suppl_1): i18 - i26.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
22/12/3586    most recent
gfm244v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Girndt, M.
Right arrow Articles by Köhler, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Girndt, M.
Right arrow Articles by Köhler, H.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?