NDT Advance Access published online on November 22, 2006
Nephrology Dialysis Transplantation, doi:10.1093/ndt/gfl641
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Association of the VEGF gene polymorphism with diabetic retinopathy in type 2 diabetes patients
Laboratory for Molecular Diagnostics of Multifactorial Diseases and Department of Nephrology, Skubiszewski Medical University, Lublin, Poland
Correspondence and offprint requests to: Correspondence and offprint requests to: Monika Buraczynska, Laboratory for Molecular Diagnostics of Multifactorial Diseases, Department of Nephrology, Skubiszewski Medical University Dr K. Jaczewskiego 8, 20-954 Lublin, Poland. Email: monika.buraczynska{at}am.lublin.pl
| Abstract |
|---|
|
|
|---|
Background. Diabetic microvascular complications are the major causes of morbidity and early mortality in diabetes. Vascular endothelial growth factor (VEGF) is a potent multifunctional cytokine which plays a key role in the pathogenesis of diabetic microvascular complications. We examined the possible association of the VEGF gene polymorphisms with diabetic nephropathy and retinopathy in type 2 diabetes patients.
Methods. Genotyping of the VEGF gene insertion/deletion (I/D) and +405 polymorphisms was done by the polymerase chain reaction (PCR) and restriction fragment length polymorphism methods. A total of 426 patients with type 2 diabetes and 493 healthy subjects were genotyped. The frequency of VEGF alleles and genotype distribution were compared in diabetic and control groups.
Results. The distribution of the VEGF DD genotype was significantly different in patients with diabetic retinopathy compared with healthy controls, entire diabetic group and patients with no complications (44 vs. 23, 30 and 21%, respectively; P < 0.01). Such differences were not observed in the diabetic nephropathy group. The odds ratio for the D allele was 2.27 (95% CI 1.593.25). The multivariate logistic regression analysis revealed that the D allele of the VEGF gene I/D polymorphism was an independent risk factor of retinopathy (P < 0.001). The VEGF +405 genotype was not associated with diabetic complications in type 2 diabetes patients.
Conclusion. Our study suggests that the I/D polymorphism in the promoter region of the VEGF gene is associated with retinopathy but not nephropathy in type 2 diabetes patients. The multivariate logistic regression analysis showed that the D allele of the VEGF polymorphism is an independent risk factor of diabetic retinopathy after controlling for other clinical variables.
Keywords: DNA polymorphism; microvascular complications; polymerase chain reaction; type 2 diabetes; vascular endothelial growth factor
| Introduction |
|---|
|
|
|---|
Diabetic microvascular complications are the major causes of morbidity and early mortality in diabetes [1, 2]. There is increasing evidence implicating genetic factors in the susceptibility to diabetic nephropathy and retinopathy [3]. Growth factors may play an important role in modifying and accelerating the tissue damage caused by hyperglycemia, a risk factor in diabetic complications [4].
Vascular endothelial growth factor (VEGF) is a potent multifunctional cytokine which plays a key role in the pathogenesis of diabetic microvascular complications [5, 6]. Some processes, such as endothelial dysfunction and increased blood vessel permeability, are observed in both, diabetic retinopathy and diabetic nephropathy [2]. VEGF is a highly conserved homodimeric glycoprotein which promotes angiogenesis and is a potent mediator of microvascular permeability [7]. It regulates vascular endothelial cell proliferation in many types of tissues including glomerular capillaries [1]. The genetic variations in the VEGF gene influence levels of VEGF protein expression [8, 9]. Dysregulated VEGF expression is implicated in many disease pathologies. Several studies have shown that VEGF expression is increased in patients with diabetic retinopathy as well as in those with nephropathy [10, 11]. In experimental models of diabetic complications, there is an increased expression of VEGF and its receptors with elevation of the protein in the kidney of experimental animals and the vascular dysfunction may also be mediated by VEGF [12].
The human VEGF gene is located on chromosome 6 (6p21.3). At least five different isoforms of VEGF are generated by alternate splicing of the VEGF-A gene [13]. The VEGF gene is highly polymorphic [9, 14, 15]. Of particular interest is an insertion/deletion (I/D) of the 18 bp fragment at 2549 position of the promoter region. Another polymorphism useful for association studies is G
C at +405 in the 5'-untranslated region. It has been implicated in a number of diseases, especially those with angiogenic basis [6, 16]. VEGF protein production was found to be associated with +405 polymorphism in healthy subjects [9].
The purpose of our study was to investigate these two polymorphisms in patients with type 2 diabetes mellitus and to assess their possible role in microvascular complications.
| Subjects and methods |
|---|
|
|
|---|
Patients and controls
The study involved 426 unrelated individuals with type 2 diabetes recruited in 20012004: 181 consecutive patients with diabetes and no nephropathy, from the outpatient diabetes clinic and 245 consecutive diabetic nephropathy patients from the dialysis center at the Department of Nephrology of University Medical School in Lublin. Type 2 diabetes was diagnosed on the basis of the WHO criteria. The patients were divided into subgroups according to their microvascular complications: patients with uncomplicated diabetes (n = 91) who had type 2 diabetes for at least 10 years but remained free of nephropathy and retinopathy; patients with nephropathy (n = 245), of whom 43% had coexisting retinopathy; patients with retinopathy (n = 195), of whom 54% had coexisting nephropathy. Diabetic nephropathy status was determined on the basis of questionnaires, clinical features and laboratory data. The albumin excretion rate (AER) was determined in three 24 h urine collections performed at least 1 month apart. Diabetic nephropathy was diagnosed clinically when the patient had persistent albuminuria
300 mg/24 h in at least two consecutive determinations in the absence of haematuria or infection. All patients with diabetic nephropathy were undergoing maintenance dialysis. Diabetic retinopathy was diagnosed by independent ophthalmologists. All patients underwent a complete ophthalmological examination, including corrected visual acuity, fundoscopic examination and fundus photography (three 45° fields per eye) at least every year. Fundoscopic findings were determined by retinal specialists. Retinopathy was diagnosed according to the Early Treatment Diabetic Retinopathy Study (ETDRS) criteria: the presence of microaneurysms, hemorrhages, cotton wool spots, intraretinal microvascular abnormalities, hard exudates, venous beading and new vessels [17]. Glycemic control was evaluated by measuring glycated HbA1c levels by turbidimetric inhibition immunoassay, TINIA, using Tina-quant haemoglobin A1cII (RocheHitachi 747). All other biochemical parameters were measured by standard laboratory procedures. Control subjects (n = 493) were healthy volunteers (mostly blood donors and hospital staff) with no history of diabetes. The urine analysis was performed in all subjects. All individuals involved in this study were Caucasians of Polish origin. Written informed consent was obtained from all subjects in accordance with principles of the Declaration of Helsinki. The protocol of the study was approved by the institutional Ethics Committee.
Determination of the VEGF genotypes
High molecular weight genomic DNA was isolated from peripheral blood leukocytes by the standard method. The I/D polymorphism was analysed using the following primers: forward 5' - GCTGAGAGTGGGGCTGACTAGGTA - 3' and reverse 5' - GTTTCTGACCTGGCTATTTCCAGG - 3'. For the VEGF G/C +405 polymorphism the forward and reverse primers were: 5' - ATTTATTTTTGCTTGCCATT - 3' and 5' - GTCTGTCTGTCTGTCCGTCA 3', respectively. Genomic DNA (300 ng) was amplified in a final volume of 30 µl using the following conditions: denaturation at 95°C for 6 min followed by 35 cycles at 94°C for 1 min, 57°C for 1.5 min and 72°C for 2 min. A final extension was at 72°C for 10 min. For the VEGF +405 polymorphism the PCR product was digested with the BsmFI restriction nuclease. The amplification products were separated by electrophoresis through 2.5% agarose gel stained with ethidium bromide. For the VEGF I/D polymorphism two bands were observed, 211 bp (D allele) and 229 bp (I allele). For the VEGF +405 polymorphism the uncut fragment was 304 bp (C allele) and digestion products were 193 and 111 bp (G allele).
Measurement of serum VEGF concentration
Serum samples were stored at 20°C. Serum VEGF levels were measured using the Human VEGF Quantikine ELISA kit (R&D Systems, Inc., Minneapolis, MN, USA).
Statistical analysis
Statistical calculations were performed using SPSS for Windows 5.0 (SPSS, Chicago, IL, USA). HardyWeinberg equilibrium for alleles at individual loci was tested with the chi-square test. Data are presented as means ± SD. Genotype distribution and allele frequencies were assessed by a chi-square test of independence with 2x2 contingency tables and z-statistics. Fisher's exact test was used to analyze allele frequencies in the various patient subgroups. Values of P (two-tailed) <0.05 were considered statistically significant. Odds ratios (OR) with 95% confidence intervals (CI) were estimated for the effects of high risk alleles. Logistic regression analysis was used to assess the role of the VEGF genotype and other coexisting factors in retinopathy. The Cochran's test was used for homogeneity of variances to assure that data are normally distributed. The data were analysed for a modification of the effect of the VEGF I/D genotype on retinopathy risk by other risk factors.
Power calculations were done using a power calculator available online (http://calculators.stat.ucla.edu). To calculate the study power, a difference in allele frequency of 0.10 was considered as relevant. To test for this difference (desired study power 80%,
-error = 0.05 two-tailed) the number of patients enrolled in the study should be 358.
| Results |
|---|
|
|
|---|
Table 1 presents the clinical and biochemical variables of the studied diabetic subjects and controls. Among the 426 patients with type 2 diabetes, 245 patients had nephropathy and 195 had retinopathy. Both complications were diagnosed in 105 subjects. There was a statistically significant difference in age between the control group and diabetes and diabetic retinopathy (DR) groups (P < 0.05). The gender distribution was similar in both diabetic and healthy groups. Patients with diabetes and nephropathy and/or retinopathy and those without diabetic complications did not differ with regard to clinical characteristics except for hypertension which was more frequent in patients with complications than in uncomplicated subgroup. Patients with diabetic retinopathy had a longer duration of disease compared with the entire diabetic group (P < 0.05).
|
All diabetic patients and control subjects were genotyped for the I/D and +405 polymorphisms in the VEGF gene.
VEGF gene I/D polymorphism at 2549
The distribution of the I/D genotype and allele frequencies in patients and controls are shown in Table 2. The frequency of genotypes did not deviate significantly from the HardyWeinberg equilibrium. The allele and genotype frequencies were similar between the entire diabetic group, diabetic nephropathy patients and diabetic patients without complications. There was a significant increase in the frequency of the DD genotype in the diabetic retinopathy patients compared with control, entire diabetic, nephropathy and uncomplicated groups (44 vs 23, 30, 21 and 21%, respectively; P < 0.01). The frequency of the D allele was also increased compared with control, entire diabetic, nephropathy and uncomplicated groups (P < 0.05). Such differences in the frequency of the DD genotype and D allele were not observed in the nephropathy patients, except for when compared with retinopathy group. The OR for the D allele, calculated vs uncomplicated subgroup, was 2.27 (95% CI 1.593.25) for diabetic retinopathy and 1.09 (95% CI 0.771.54) for nephropathy. While calculated vs control group, the values were 1.84 (95% CI 1.442.34) and 0.89 (95% CI 0.711.09), respectively. We also compared the genotype and allele frequencies in patients with retinopathy alone (n = 90), nephropathy alone (n = 140) and those with uncomplicated diabetes (n = 91). For retinopathy alone there was a large increase in the frequency of the DD genotype and the D allele compared with nephropathy alone and uncomplicated subgroups. The DD genotype frequencies were 63% in retinopathy alone vs 16% in nephropathy alone and 21% in uncomplicated (P < 0.01) and the D allele frequency was 0.77 vs 0.41 and 0.45, respectively (P < 0.05). The differences between the nephropathy alone and uncomplicated subgroups were not statistically significant. The DD genotype frequency was 16% compared with 21% in uncomplicated, and the D allele frequency was 0.41 compared with 0.45, respectively. We also compared genotype and allele frequencies between male and female subjects and found no effect of sex on observed genotypes (data not shown).
|
The power of the present study for detecting the allele difference between diabetic retinopathy patients and controls as significant (with
-error = 0.05 two-tailed) was 97.6%. A multivariate logistic regression analysis was performed with the VEGF genotype and several clinical features as independent variables and the presence or absence of retinopathy as dependent variable. The analysis indicates that in addition to the duration of diabetes (P < 0.01), the D allele of the VEGF I/D polymorphism had a significantly increased risk of retinopathy (OR 2.70; 95% CI 1.255.82; P =0.001), suggesting that this allele is an independent risk factor of diabetic retinopathy. We found no statistically significant effect modification by VEGF I/D polymorphism of retinopathy risk associated with other variables. The ORs for variables such as age, age at onset and HbA1c did not differ by the VEGF genotype.
VEGF gene +405 polymorphism
We have also performed screening with the +405 VEGF gene polymorphism. There were no significant differences in genotype distribution and allele frequencies when compared between controls and studied subgroups with and without diabetic complications (Table 3).
|
VEGF serum levels
To assess possible biological relevance of the VEGF I/D polymorphism, serum VEGF levels were measured in duplicate in randomly selected retinopathy patients and controls (20 with DD genotype and 20 with II genotype from each group). No statistically significant difference was observed between diabetic and control subjects (P = 0.52). Increased serum VEGF levels were observed in retinopathy patients with the DD genotype compared with those with the II genotype, but the difference did not reach statistical significance (249.6 vs 198.7 pg/ml, P = 0.12).
| Discussion |
|---|
|
|
|---|
VEGF plays an important role in the pathogenesis of diabetic microvascular complications. Diabetic retinopathy is characterized by increased vascular permeability, tissue ischemia and neovascularization. VEGF can stimulate angiogenesis and increases the permeability of the microvasculature [7, 1820]. The VEGF gene was previously found to be implicated in the development of diabetic retinopathy. In the study of Awata et al. [6] involving type 2 diabetic subjects, the C(634)G polymorphism in the 5'UTR of the VEGF gene was strongly associated with an increased risk of retinopathy. The same authors [21] studied the effect of three VEGF gene polymorphisms on the development of diabetic macular edema. Their results demonstrate that the VEGF C(634)G polymorphism is a genetic risk factor for macular oedema as well as diabetic retinopathy. The results from another study, in patients with both type 1 and type 2 diabetes, indicate that the VEGF 460 polymorphism is an independent risk factor for the development of proliferative diabetic retinopathy [22].
We investigated the potential association of two VEGF gene polymorphisms with nephropathy and retinopathy in patients with type 2 diabetes. The presented results show that the DD genotype and the D allele of the VEGF gene I/D polymorphism may be associated with susceptibility to diabetic retinopathy but not nephropathy in type 2 diabetes patients which might reflect some cell-specific effects of VEGF polymorphism. Also the precise role of VEGF in diabetic nephropathy is still uncertain. It is not known whether expression of VEGF is, at least in part, the cause of pathological changes in nephropathy or rather represents a reparative response as a consequence of pre-existing tissue and functional alterations [1].
By applying the multivariate logistic regression analysis we found that the genotype of the VEGF I/D polymorphism is an independent risk factor of retinopathy. The results of in vitro functional studies suggest that the presence of the D allele at 2549 in the promoter region of the VEGF gene leads to enhanced expression of the gene [12]. Previous studies have also shown that polymorphisms in the promoter as well as the 3' untranslated regions of the VEGF gene affect the production of VEGF [9]. The association of the D allele with the susceptibility to diabetic retinopathy can be explained in part by the enhanced level of transcription compared with the I allele. This would likely result in elevated levels of VEGF in these patients compared with the uncomplicated subjects carrying the I allele. The similar explanation was proposed by Yang et al. [23] who observed the effect of the I/D VEGF polymorphism on susceptibility to diabetic nephropathy in type 1 diabetic patients. We observed increased serum VEGF levels in retinopathy patients with the DD genotype compared with those with the II genotype. The difference was not statistically significant, probably due to the small number of samples (20 from each subgroup).
Although there was no detectable effect of the VEGF gene polymorphism on diabetic nephropathy, a limitation of our study is an inadequate number of patients required by power analysis for the type II error.
We have also screened the same patient population for the VEGF +405 polymorphism. There was no association found between +405 genotype and diabetic nephropathy or retinopathy in our patient population. This is in agreement with the results of Ray et al. [22]. They found no significant association between retinopathy status and the VEGF +405 polymorphism. The results are contradictory to the study by Awata et al. [6], where +405 polymorphism (634 polymorphism in their report) was strongly associated with diabetic retinopathy in Japanese subjects. This might be due to different ethnicity of the patients, among other factors.
In conclusion, our data suggest that the I/D polymorphism in the promoter region of the VEGF gene is associated with the susceptibility to diabetic retinopathy in type 2 diabetes patients. In logistic regression analysis the VEGF genotype was an independent risk factor for diabetic retinopathy after controlling for other clinical variables. The function of this polymorphism is still unclear. The presence of the deletion allele is probably linked to increased transcriptional activity. Prospective studies in larger diabetic patient populations as well as the functional studies are needed to elucidate the role of the VEGF I/D polymorphism in diabetic microvascular complications.
| Acknowledgements |
|---|
|
|
|---|
This study was supported by a research KBN grant 2 PO5B 133.26.
Conflict of interest statement. None declared.
| References |
|---|
|
|
|---|
- Aiello LP and Wong J-S. (2000) Role of vascular endothelial growth factor in diabetic vascular complications. Kidney Int 58:Suppl 77, S113S119.[CrossRef]
- De Vriese AS, Verbeuren TJ, Van de Voorde J, Lameire NH, Vanhoutte PM. (2000) Endothelial dysfunction in diabetes. Br J Pharmacol 130:963974.[CrossRef][Web of Science][Medline]
- Parving HH, Tarnow L, Rossing P. (1996) Genetics of diabetic nephropathy. J Am Soc Nephrol 7:25092517.[Abstract]
- Adler SG, Pahl M, Seldin MF. (2000) Deciphering diabetic nephropathy: progress using genetic strategies. Curr Opin Nephrol Hypertens 9:99106.[CrossRef][Web of Science][Medline]
- Gröne HJ. (1995) Angiogenesis and vascular endothelial growth factor (VEGF): is it relevant in renal patients? Nephrol Dial Transplant 10:761763.
[Free Full Text] - Awata T, Inoue K, Kurihara S, et al. (2002) A common polymorphism in the 5'-untranslated region of the VEGF gene is associated with diabetic retinopathy in type 2 diabetes. Diabetes 51:16351639.
[Abstract/Free Full Text] - Ferrara N and Davis-Smyth T. (1997) The biology of vascular endothelial growth factor. Endocr Rev 18:425.
[Abstract/Free Full Text] - Renner W, Kotschan S, Hoffmann C, Obermayer-Pietsch B, Pilger E. (2000) A common 936 C/T mutation in the gene for vascular endothelial growth factor is associated with vascular endothelial growth factor plasma levels. J Vasc Research 37:443448.
- Watson CJ, Webb NJA, Bottomley MJ, Brenchley PE. (2000) Identification of polymorphisms within the vascular endothelial growth factor (VEGF) gene: correlation with variation in VEGF protein production. Cytokine 12:12321235.[CrossRef][Web of Science][Medline]
- Cha DR, Kim NH, Yoon JW, et al. (2000) Role of vascular endothelial growth factor in diabetic nephropathy. Kidney Int 58:Suppl 77, S104S112.
- Chiarelli F, Spagnoli A, Basciani F, et al. (2000) Vascular endothelial growth factor (VEGF) in children, adolescents and young adults with type 1 diabetes mellitus: relation to glycaemic control and microvascular complications. Diabet Med 17:650656.[CrossRef][Web of Science][Medline]
- Cooper ME, Vranes D, Youssef S, et al. (1999) Increased renal expression of vascular endothelial growth factor (VEGF) and its receptor VEGFR-2 in experimental diabetes. Diabetes 48:22292239.[Abstract]
- Vincenti V, Cassano C, Rocchi M, Persico G. (1996) Assignment of the vascular endothelial growth factor gene to human chromosome 6p21.3. Circulation 93:14931495.
[Abstract/Free Full Text] - Brogan IJ, Khan N, Isaac K, Hutchinson JA, Pravica V, Hutchinson IV. (1999) Novel polymorphisms in the promoter and 5' UTR regions of the human vascular endothelial growth factor gene. Hum Immunol 60:12451249.[CrossRef][Web of Science][Medline]
- Stevens A, Soden J, Brenchley PE, Ralph S, Ray DW. (2003) Haplotype analysis of the polymorphic human vascular endothelial growth factor gene promoter. Cancer Res 63:812816.
[Abstract/Free Full Text] - Summers A, Coupes BM, Brennan MF, Ralph SA, Short CD, Brenchley PE. (2005) VEGF 460 genotype plays an important role in progression to chronic kidney disease stage 5. Nephrol Dial Transplant 20:24272432.
[Abstract/Free Full Text] - Early Treatment Diabetic Retinopathy Study Research Group. (1991) Grading diabetic retinopathy from stereoscopic color fundus photographs - an extension of the modified Airlie House classification. ETDRS report number 10. Ophthalmology 98:786806.[Web of Science][Medline]
- Murata T, Ishibashi K, Khalil A, Hata Y, Yoshikawa H, Inomata H. (1995) Vascular endothelial growth factor plays a role in hyperpermeability of diabetic retinal vessels. Ophthalmic Research 27:4852.[Web of Science][Medline]
- Ferrara N. (1995) Vascular endothelial growth factor: the trigger for neovascularization in the eye. Lab Invest 72:615618.[Web of Science][Medline]
- Witmer AN, Vrensen GF, Van Noorden CJF, Schlingemann RO. (2003) Vascular endothelial growth factors and angiogenesis in eye disease. Prog Retin Eye Res 22:129.[CrossRef][Web of Science][Medline]
- Awata T, Kurihara S, Takata N, et al. (2005) Functional VEGF C-634G polymorphism is associated with development of diabetic macular edema and correlated with macular retinal thickness in type 2 diabetes. Biochem Biophys Res Comm 333:679685.[CrossRef][Web of Science][Medline]
- Ray D, Mishra M, Ralph S, Read J, Davies R, Brenchley P. (2004) Association of the VEGF gene with proliferative diabetic retinopathy but not proteinuria in diabetes. Diabetes 53:861864.
[Abstract/Free Full Text] - Yang B, Cross DF, Ollerenshaw M, Millward BA, Demaine AG. (2003) Polymorphisms of the vascular endothelial growth factor and susceptibility to diabetic microvascular complications in patients with type 1 diabetes mellitus. J Diabetes Complications 17:16.[Web of Science][Medline]
Accepted in revised form: 6.10.06
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
S. Abhary, K. P. Burdon, A. Gupta, S. Lake, D. Selva, N. Petrovsky, and J. E. Craig Common Sequence Variation in the VEGFA Gene Predicts Risk of Diabetic Retinopathy Invest. Ophthalmol. Vis. Sci., December 1, 2009; 50(12): 5552 - 5558. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Zarbock, D. Hendig, C. Szliska, K. Kleesiek, and C. Gotting Vascular endothelial growth factor gene polymorphisms as prognostic markers for ocular manifestations in pseudoxanthoma elasticum Hum. Mol. Genet., September 1, 2009; 18(17): 3344 - 3351. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. P. Schneider, M. Radovich, and K. D. Miller The Role of Vascular Endothelial Growth Factor Genetic Variability in Cancer Clin. Cancer Res., September 1, 2009; 15(17): 5297 - 5302. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Sharma, A. J. Murphy, M. E. Soto-Quiros, L. Avila, B. J. Klanderman, J. S. Sylvia, J. C. Celedon, B. A. Raby, and S. T. Weiss Association of VEGF polymorphisms with childhood asthma, lung function and airway responsiveness Eur. Respir. J., June 1, 2009; 33(6): 1287 - 1294. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. P. Schneider, M. Wang, M. Radovich, G. W. Sledge, S. Badve, A. Thor, D. A. Flockhart, B. Hancock, N. Davidson, J. Gralow, et al. Association of Vascular Endothelial Growth Factor and Vascular Endothelial Growth Factor Receptor-2 Genetic Polymorphisms With Outcome in a Trial of Paclitaxel Compared With Paclitaxel Plus Bevacizumab in Advanced Breast Cancer: ECOG 2100 J. Clin. Oncol., October 1, 2008; 26(28): 4672 - 4678. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Al-Kateb, L. Mirea, X. Xie, L. Sun, M. Liu, H. Chen, S. B. Bull, A. P. Boright, A. D. Paterson, and for the DCCT/EDIC Research Group Multiple Variants in Vascular Endothelial Growth Factor (VEGFA) Are Risk Factors for Time to Severe Retinopathy in Type 1 Diabetes: The DCCT/EDIC Genetics Study Diabetes, August 1, 2007; 56(8): 2161 - 2168. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||





