NDT Advance Access originally published online on November 28, 2007
Nephrology Dialysis Transplantation 2008 23(2):776; doi:10.1093/ndt/gfm677
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Unusual saprophytic bacterial infection as emerging opportunistic pathogens in kidney transplantation
E-mail: giuseppe_orlando{at}hotmail.com
Sir,
A 33-year-old man underwent cadaver renal transplantation for polycystic kidney disease. Immunosuppression consisted of basiliximab, tacrolimus, mycophenolic acid (MA) and steroids. Resumption of kidney function was immediate, and the patient was discharged on Day 11. On Day 75, white blood cell (WBC) count dropped to 1640 cells/ml. Viral infections being ruled out, all myelotoxic drugs but tacrolimus were withdrawn. Tacrolimus was stopped when WBC count further dropped to 280 cells/ml on Day 78. Filgrastim was successfully given. The patient became febrile on Day 80. Blood, urines, sputum and bronco-alveolar lavage were unsuccessfully screened for infections. On Day 83, the patient developed dyspnoea due to massive left pleural effusion. Pleural liquid was collected and cultured several times. Finally, incubation of samples in Bact Alert 3D showed positive growth in anaerobic conditions after 7 days, but subcultures on Shaedler agar failed in obtaining any growth. Only subcultures, on pre-reduced Columbia blood agar plates adequately supplemented, showed very small colonies of irregularly Gram-stained anaerobic rods, whose identification was possible by universal 16S rRNA PCR using the following broad range primers: u3(AACT(C/A)CGTGCCAGCAGCCGCGGTAA) and ru8 (AAGGAGGTGATCCA(G/A)CCGCA(G/C)(G/C) TTC [1]. The 1000-bp sequence was aligned and compared with all eubacterial 16S rRNA gene sequences available in the GenBank database (http://www.ncbi.nml.nih.gov) [2]. A 100% similarity was obtained with Eubacterium plautii (EP) strain CCUG 28093 16S rRNA gene sequence (GenBank/EMBL accession no. AY724678). Unfortunately, the identification of the germ was obtained after the patient had already been discharged. In the long run, the withdrawal of tacrolimus and MA triggered a rejecting process leading to irreversible renal failure and graft was removed on Day 123.
This is the very first case of EP infections in a transplant patient and the second ever in humans [3]. EP is characterized by an extremely slow and minimal growth on the media commonly used in clinical microbiology laboratories, which renders its identification fastidiously and is rarely available. Prolonged incubation of plates and broth and use of enriched media are key factors for successful diagnosis. However, the time and effort required for isolation and identification means that, in many instances, no attempt in isolation is made and even if isolated, identification is problematic, for which we should assume that these isolates are often—if not regularly—missed [4]. Recently, molecular biological techniques—such as sequence analysis of clone libraries from amplified ribosomal DNA and denaturing or temperature-gradient gel electrophoresis—have been increasingly applied to study the complexity of resident microbial communities and have demonstrated the enormous diversity of commensal intestinal species. In our setting, analysis of the 16S rRNA sequence of the organism provided a reliable and straightforward identification tool and the routine use of this method should increase our knowledge of the clinical spectrum of this rare infection in humans.
1Transplant Unit, San Salvatore
Hospital, University of L’Aquila,
Italy
2Department of Infectious, Parasitic
and Immune-mediated Diseases,
Istituto Superiore di Sanità, Roma,
Italy
3Department of Internal Medicine,
Chair of Hematology, University of
L’Aquila, Italy
Acknowledgements
We are indebted to Miss Wendy Batten for editorial services.
Conflict of interest statement. None declared.
Notes
See http://ndtplus.oxfordjournals.org/
References
- Goldenberger D, Kunzli A, Vogt P, et al. Molecular diagnosis of bacterial endocarditis by broad-range PCR amplification and direct sequencing. J Clin Microbiol (1997) 176:672–677.
- Radstrom P, Backman A, Qian N, et al. Detection of bacterial DNA in cerebrospinal fluid by an assay for simultaneous detection of Neisseria Meningitiis, Haemophilus, Influenzae and Streptococci using a seminested PCR strategy. J Clin Microbiol (1994) 32:2738–2744.
[Abstract/Free Full Text] - Garre M, le Henaff C, Tande, et al. Fulminant Eubacterium plautii infection following dog bite in asplenic man. Lancet (1991) 338:384–385.[Web of Science][Medline]
- Hill GB, Ayers OM, Kohan AP. Characteristics and site of infection of Eubacterium nodatum, Eubacterium timidum, Eubacterium brachy, and other asaccharolytic eubacteria. J Clin Microbiol (1987) 25:1540–1545.
[Abstract/Free Full Text]
CiteULike 
Connotea 
Del.icio.us What's this?
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||