Skip Navigation


NDT Advance Access originally published online on November 2, 2006
Nephrology Dialysis Transplantation 2007 22(2):409-416; doi:10.1093/ndt/gfl619
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
22/2/409    most recent
gfl619v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (1)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Cardinal, H.
Right arrow Articles by Madore, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cardinal, H.
Right arrow Articles by Madore, F.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author [2006]. Published by Oxford University Press on behalf of ERA-EDTA. All rights reserved. For Permissions, please email: journals.permissions@oxfordjournals.org

Uraemic plasma decreases the expression of ABCA1, ABCG1 and cell-cycle genes in human coronary arterial endothelial cells

Héloise Cardinal1, Marc-André Raymond1, Marie-Josée Hébert1 and François Madore2

1Department of Medicine, Centre Hospitalier de l’Université de Montréal and 2Department of Medicine, Hôpital du Sacré-Coeur de Montréal, Canada

Correspondence and offprint requests to: Dr François Madore, Centre de Recherche, Hôpital du Sacré-Coeur de Montréal, 5400, Blvd Gouin, Montreal, QC, Canada H4J 1C5. Email: f.madore{at}umontreal.ca



   Abstract
Top
 Abstract
Introduction
 Subjects and methods
 Results
 Discussion
 Acknowledgements
 References
 
Background. Uraemia is associated with endothelial dysfunction, but the effect of uraemic plasma on the gene expression pattern of human coronary arterial endothelial cells (HCAEC) has never been defined.

Methods. HCAECs were exposed for 48 h to a culture medium supplemented with 20% uraemic vs normal plasma. We extracted mRNA and hybridized it onto Affymetrix HG-U133 Plus2 microarrays. We validated our findings for five genes of interest by real-time PCR and performed evaluations of cell proliferation and apoptosis in HCAECs exposed to uraemic vs normal plasma.

Results. Six genes involved in the regulation of cell-cycle progression (CDK-1, topoisomerase II, PDZ-binding kinase, CDCA1, protein SDP35, E2F transcription factor 8) and two genes of the cholesterol efflux system (ABCA1 and ABCG1) were down-regulated in HCAECs exposed to uraemic plasma (>1.75-fold change vs normal). Real-time PCR confirmed the down-regulation observed in the microarray experiment. Cell proliferation was significantly decreased in HCAECs exposed to uraemic vs normal plasma for 48 h (86 vs 95% of serum-starved control, P = 0.006). Exposure to uraemic plasma for 48 h was associated with increased apoptosis of HCAEC as compared with normal plasma (7.7 vs 2.8%, P < 0.001), a phenomenon that was further enhanced when oxidized LDLs (150 µg protein/ml) were added to the medium containing uraemic plasma (16.9 vs 7.7%, P < 0.001).

Conclusions. The down-regulation of genes involved in cell-cycle progression and cholesterol efflux from HCAECs exposed to uraemic conditions could contribute to enhancing endothelial dysfunction and atherosclerosis in patients with chronic renal failure.

Keywords: apoptosis; atherosclerosis; cell proliferation; endothelial cells; gene expression; uraemia



   Introduction
Top
 Abstract
 Introduction
Subjects and methods
 Results
 Discussion
 Acknowledgements
 References
 
In the past decade, the important role of endothelial cell (EC) dysfunction in the pathogenesis of atherosclerosis (ASO) has been clearly demonstrated [1–7]. Proatherogenic factors such as oxidized lipids, diabetes mellitus and tobacco smoking are associated with EC dysfunction [8–11] and apoptosis [12–14]. Both EC dysfunction and apoptosis induce multiple biological effects that can mediate the progression and clinical expression of ASO. They compromise vasoregulation [1–7], enhance blood coagulation [15,16], promote infiltration of inflammatory cells and lipids into the intima [17,18], and increase vascular smooth muscle cell (VSMC) migration and proliferation [19,20].

The mortality rate from cardiovascular disease (CVD) in patients who suffer from chronic renal failure (CRF) is at least 3.5 times that of the general population [21]. While the high prevalence of traditional risk factors for ASO undoubtedly contributes to the accelerated rate of CVD in patients with CRF [22,23], they account for only a fraction of the excessive burden of heart disease experienced by these patients [24]. Hence, other mechanisms have been suggested to explain the accelerated ASO sustained by patients with kidney disease. CRF is associated with endothelial dysfunction [25–28]. The impairment in endothelium-dependent vasodilatation observed in these patients is correlated with the severity of renal failure [25]. In addition, EC dysfunction has been reported to represent an independent risk factor for mortality in patients undergoing haemodialysis [29].

The mechanisms involved in CRF-associated endothelial dysfunction remain obscure. Some evidence suggests that accumulating uraemic solutes can induce endothelial dysfunction. For instance, hyperhomocysteinaemia is associated with impaired endothelium-dependent vasodilation in both normotensive and hypertensive subjects [30]. Advanced glycation end products can increase endothelial permeability [31] and the expression of endothelial adhesion molecule [32]. However, the gene expression pattern of ECs induced by uraemic plasma and solutes is unknown at the present time.

The aim of this study was to determine which genes were differentially expressed in human coronary arterial endothelial cells (HCAECs) exposed to a medium supplemented with uraemic vs normal human plasma, using DNA microarrays. We then validated the microarray findings with real-time PCR techniques and assessed their significance by performing functional assays.



   Subjects and methods
Top
 Abstract
 Introduction
 Subjects and methods
Results
 Discussion
 Acknowledgements
 References
 
Overview
HCAECs were grown in endothelial culture medium and exposed to a medium supplemented with 20% uraemic or 20% normal plasma for 48 h. RNA was extracted, reverse transcribed into cDNA and hybridized onto Affymetrix® GeneChips for microarray analysis. Results of the microarray analysis were validated with real-time PCR techniques. In addition, functional assays (i.e. evaluation of cell proliferation and evaluation of apoptosis) were performed to assess the significance of microarray findings. The ethics review board of the Centre Hospitalier de l’Université de Montréal and Hôpital du Sacré-Coeur de Montréal gave their approval to the study.

Management, collection and provenance of human plasma
Blood samples were collected from healthy volunteers and end-stage renal disease (ESRD) patients on thrice-weekly chronic haemodialysis. All participants provided informed consent. Blood was collected in 10 ml tubes containing ethylenediaminetetraacetic acid (EDTA), sent on ice to the laboratory, and centrifuged (1300g for 10 min). Plasma was then aliquoted and stored at –80°C. Plasma was not pooled. Each plasma was used for an individual experiment. Two different subsets of ESRD patients provided plasma for the different experiments conducted during this study: microarray analysis (n = 6), cell proliferation assay and apoptosis assay (n = 10). The characteristics of patients providing plasma in the two uraemic groups are provided in Table 1. Similarly, different healthy volunteers provided plasma for the various experiments. Three healthy volunteers served as a control group for the microarray study. Their mean age was 40.0 ± 5.0 years, and 66% were of female gender. For the cell proliferation and the apoptosis assays, 10 healthy volunteers served as controls. They were matched for gender and age (5 year calliper) with each uraemic subject. All control subjects had normal kidney function, no history of vascular disease, diabetes, dyslipidaemia or smoking. They used no medication.


View this table:
[in this window]
[in a new window]

  		Table 1. Characteristics of patients providing plasma

 
Culture of endothelial cells
HCAECs were obtained from Clonetics (San Diego, CA) and used at passages 2 up to 4. The cells were seeded on gelatin-coated (1%) tissue culture plates (Becton-Dickinson, Franklin Lakes, NJ) and cultured in endothelial culture medium (EBM-EGM-MV; Clonetics, San Diego, CA). They were maintained in a humidified atmosphere containing 5% CO2-95% air at 37°C. Monolayers of confluent HCAECs were then exposed to EBM (Clonetics, San Diego, CA) supplemented with either 20% plasma from healthy volunteers (normal group) or 20% plasma from patients with ESRD (uraemic group) for 48 h. We studied HCAECs at confluence to reproduce in vivo conditions, in which the endothelium does not have a high cell turnover and its cells are not in the exponential growth phase [33]. We chose to expose the cells for 48 h since our aim was to mimic chronic exposure to the uraemic environment, although this time point did not permit us to observe early events.

RNA extraction and microarray hybridization
After exposure to the different experimental conditions, HCAECs were collected with the use of trypsin followed by centrifugation. They were washed in phosphate-buffered saline (PBS), centrifuged, and frozen at –80°C. RNA extraction was performed using a commercially available kit (RNeasy, QIAgen, Burlington, ON, Canada). The quality of the RNA was monitored by gel electrophoresis and a 2100 Bioanalyzer, using the RNA 6000 Nano LabChip kit (Agilent Technologies, Germany). RNA was transcribed into cDNA with a double reverse transcriptase-PCR technique, and in vitro transcription was performed to generate biotin-labelled cRNA for subsequent hybridization on HG-U133 Plus2 GeneChips® (Affymetrix, Santa Clara, CA). This chip contains 38,500 well-characterized human genes, and further information on its characteristics can be found at http://www.affymetrix.com/support/technical/datasheets/human_datasheet.pdf. The detailed protocols used for transcription and hybridization are available at https://genomequebec.mcgill.ca/nanuqAdministration/nanuq-administration/protocols.go. There were six biological replicates in the uraemic group, and three in the normal group. We did not perform technical replicates. Hybridized target cRNA was stained with streptavidin phycoerythrin and arrays were scanned using a GeneArray® Scanner (Affymetrix, Santa Clara, CA) at an excitation wavelength of 488 nm.

Real-time PCR validation
RNA extracted from HCAECs in the previous experiment was reverse transcribed in cDNA by reverse transcriptase-PCR using Super-Script preamplification system (Invitrogen, ON, Canada). The PCR reaction (95°C for 15 min, 40 cycles of 95°C for 15 s, 60°C for 30 s, 72°C for 30 s) was performed using conventional PCR conditions, with a Rotor-gene 3000 Real-Time Centrifugal DNA Amplification System (Corbett Tumor Tissues Research, NSW, Australia). We used the QuantitectTM SYBR Green PCR (Qiagen, ON, Canada) reaction mixture according to the manufacturer's instructions. We performed serial dilutions to generate a standard curve for each gene tested in order to define the efficiency of the Q-PCR reaction, and a melt curve analysis was done to confirm the specificity of the reaction. Based on the stability of its expression in microarray experiments, we used primers for the GAPDH gene as internal controls. The parameter CT (cycle threshold) value was measured to determine starting copy number of target genes using the standard curve. The sequences for ABCA1 primers were as follows: Fwd 5'AAGCACTTCCTCCGAGTCAA3' and Rev 5'TTCAGGGGATGATTGAAAGC3'; for ABCG1: Fwd 5'ACGCAGTTCTGCATCCTCTT3' and Rev 5'CGGAGTTGCTCAAGACCTTC3'; for CDCA1: Fwd 5'GTGATGACGGTTGACGTTTG3' and Rev 5'AATCTCCCAGGCTCTGGTTT3'; for CDK-1: Fwd 5'CCATGGGGATTCAGAAATTG3' and Rev 5'CCATTTTGCCAGAAATTCGT3'; for topoisomerase II: Fwd 5'TTCTTGATATGCCCCTTTGG3' and Rev 5'CGGAGAAGGCAAAACTTCAG3' and for GAPDH: Fwd 5'CAGCCTCAAGATCATCAGCA3' and Rev 5'AGGGGTCTACATGGCAACTG3' (Invitrogen, ON, Canada).

Evaluation of cell proliferation
HCAECs were cultured to 80% confluence and exposed for 48 h to EGM containing either 20% plasma from patients on haemodialysis (n = 10) or 20% plasma from healthy volunteers (n = 10). Measurement of BrdU incorporation during DNA synthesis was performed using a Cell Proliferation ELISA BrdU (colorimetric) kit (Roche Diagnostics, GmbH, Germany) according to the protocol provided by the manufacturer and as we described previously [19,34,35].

Evaluation of apoptosis
HCAECs were cultured to confluence and exposed for 48 h to the following four different experimental conditions: HCAECs were exposed to EGM containing 20% plasma from healthy volunteers (n = 10), 20% normal plasma supplemented with oxLDLs (150 µg protein/ml; Biomedical Technologies Inc., MA, USA) (n = 10), 20% plasma from uraemic patients on haemodialysis (n = 10), and 20% uraemic plasma supplemented with oxLDLs (150 µg protein/ml) (n = 10). We assessed apoptosis with fluorescence microscopy after staining HCAECs with Hoechst 33342 [2'-(4 ethoxyphenyl)-5-(4-methyl-1-piperazinyl)-2.5'-bi-1H-benzimidazole;HT)] and propidium iodide (PtdIns), and used a positive control for apoptosis (serum-starved conditions, data not shown) as described in previous work [17,34–36].

Statistical analysis
In the microarray analysis, summary measures for the expression signal of each probeset was provided (in log base 2) after background correction and quantile normalization, with the robust multi-chip averaging method (RMA) [37]. The average expression of each probeset within each treatment group was calculated. The differences (log (u) – log (n)) between the averages in the uraemic (u) and the normal (n) group were found for each probeset, and are equivalent to the logged fold change log (u/n). We then performed an inverse log function and considered that genes were differentially expressed when the unlogged absolute value of the ratio of the average signal in the uraemic group over the average signal in the normal group was greater than 1.75. We identified the genes of interest with the Affymetrix® website, which links probesets from the microarray to their respective gene annotation [38]. In the real-time PCR analysis, the expression of each gene of interest was reported as a ratio of its expression over that of GAPDH. We averaged these ratios in the uraemic and the normal group. We tested the difference in the mean expression of each gene of interest in the uraemic vs the normal group with a two-tailed, two-sample equal variance Student's t-test. We measured cell proliferation as BrdU incorporation in each group, compared with serum-starved conditions. Since the Shapiro–Wilk W statistic failed to reject the null hypothesis of a normal distribution for BrdU incorporation and percentage of apoptotic cells, we used a two-tailed two-sample equal variance Student's t-test to verify whether mean BrdU incorporation and mean percentage of apoptotic cells differed between uraemic and normal conditions.



   Results
Top
 Abstract
 Introduction
 Subjects and methods
 Results
Discussion
 Acknowledgements
 References
 
Microarray experiment
In brief, HCAECs were grown in EBM-EGM-MV and used at confluence. They were exposed to a medium supplemented with 20% uraemic or 20% normal plasma for 48 h. RNA was extracted, transcribed in cDNA and hybridized onto Affymetrix® HG-U133 Plus2 GeneChips. Using the aforementioned pre-determined criteria, we found 11 genes to be differentially expressed between the two experimental conditions (Table 2). Six genes (CDK-1, topoisomerase II, PDZ-binding kinase, CDCA1, protein SDP35, E2F transcription factor 8) are involved in cell-cycle progression. All were down-regulated in uraemic vs normal conditions. Two genes (ABCA1 and ABCG1) coded for proteins involved in cholesterol efflux from the cells. Both were also down-regulated in uraemic conditions. CXCL-11, a chemokine, was down-regulated in uraemic conditions, whereas two members of the cytochrome P450 family (CYP 26B1, CYP 1A1) were up-regulated in the uraemic group.


View this table:
[in this window]
[in a new window]

  		Table 2. Differentially expressed genes: microarray experiment

 
Real-time PCR validation
We performed real-time PCR validation for five genes of interest on the same RNA that was extracted from HCAECs in the microarray experiment. We chose to validate both genes involved in cholesterol efflux from the cells, and three genes (CDK-1, topoisomerase II and CDCA1) involved in cell-cycle progression (Table 3). We validated CDCA1 for the magnitude of its fold change in the normal vs uraemic group. CDK-1 was chosen for its crucial role in mitosis initiation and topoisomerase-2 for the evidence supporting its use as a cell proliferation marker in various tumour types [39,40]. By real-time PCR, both genes involved in cholesterol efflux from the cells were down-regulated in uraemic conditions. Hence, we observed lower ABCA1/GAPDH (0.61 vs 1.48, P = 0.03) and ABCG1/GAPDH ratios (0.71 vs 1.06, P ≤ 0.01) in uraemic vs normal conditions. For genes involved in cell-cycle progression, the CDCA1/GAPDH (0.56 vs 1.01, P ≤ 0.01), CDK-1/GAPDH (0.63 vs 1.26, P ≤ 0.01) and topoisomerase II/GAPDH (0.39 vs 0.88, P ≤ 0.01) ratios were all significantly lower in HCAEC exposed to uraemic vs normal conditions.


View this table:
[in this window]
[in a new window]

  		Table 3. Differentially expressed genes: real-time PCR validation

 
Cell proliferation
Given the observed down regulation of many genes involved in cell-cycle progression, we sought to evaluate the impact of the uraemic environment on EC proliferation. HCAECs were exposed for 48 h to a culture medium supplemented with 20% uraemic vs normal plasma. BrdU incorporation was significantly decreased in HCAEC exposed to uraemic vs normal plasma (86.0 vs 95.4% of serum starved milieu, P = 0.006). Hence, in a uraemic environment, EC proliferation was decreased by 10% with respect to that observed in normal conditions, supporting the microarray findings (Figure 1).


Figure 1
View larger version (12K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 1. Percent BrdU incorporation in HCAEC exposed to medium supplemented with normal or uraemic plasma. Difference in mean BrdU incorporation in HCAEC exposed to medium supplemented with uraemic plasma (n = 10) vs normal plasma (n = 10) at 48 h (86 vs 95% of serum-starved control, P = 0.006).

 
Apoptosis
Given the observed down regulation of genes involved in cholesterol efflux from cells (ABCA1 and ABCG1), we sought to evaluate the impact of uraemic plasma on cholesterol-induced apoptosis of ECs. HCAECs were grown in EBM-EGM-MV and used at confluence. They were then exposed for 48 h to EBM containing 20% plasma from healthy volunteers alone or supplemented with oxidized low-density lipoproteins (oxLDLs), and to EBM containing 20% plasma from uraemic subjects alone or supplemented with oxLDLs. There was a significant increase in the percentage of apoptotic cells (Figure 2) at 48 h when HCAECs were exposed to uraemic plasma alone vs normal plasma (7.7 vs 2.8%, P ≤ 0.001). A further significant increase was observed when oxLDLs and uraemic plasma were combined compared with medium containing uraemic plasma alone (16.9 vs 7.7%, P ≤ 0.001). The oxLDLs alone had a pro-apoptotic effect when compared with normal plasma alone (13.1% vs 2.8%, P ≤ 0.001). The percentage of necrotic cells was 1.9% in the presence of medium supplemented with normal plasma, and 1.2% with uraemic plasma.


Figure 2
View larger version (18K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 2. Percent apoptotic HCAECs when exposed to medium supplemented with normal or uraemic plasma and oxLDLs. Difference in mean percent apoptotic cells in HCAEC exposed to medium supplemented with uraemic (n = 10) vs normal (n = 10) plasma (7.7 vs 2.8%, P < 0.001), with oxLDLs and uraemic (n = 10) plasma vs uraemic (n = 10) plasma alone (16.9 vs 7.7%, P < 0.001), or with oxLDLs and normal (n = 10) plasma vs normal (n = 10) plasma alone (13.1 vs 2.8%, P < 0.001).

 


   Discussion
Top
 Abstract
 Introduction
 Subjects and methods
 Results
 Discussion
Acknowledgements
 References
 
Uraemic patients experience an increased burden of CVD [21]. Endothelial dysfunction, a major player in the pathogenesis of ASO, is also associated with CRF [25–28]. However, the mechanisms that underline this association remain unclear. The gene expression profile of ECs in response to uraemia had never been examined previously. In this study, we found that exposure to uraemic plasma causes a down-regulation of genes involved in cholesterol efflux from the cells and increases apoptosis in HCAECs. Furthermore, HCAECs respond to uraemic plasma with a down-regulation of genes involved in cell-cycle progression and decreased cell proliferation.

Two genes (ABCA1 and ABCG1) coding for proteins involved in cholesterol efflux from cells were found to be down-regulated in uraemic conditions. ABCG1 plays a critical role in lipid homeostasis by controlling efflux of cellular cholesterol to HDL [41]. Disruption of ABCG1 in mice results in massive accumulation of lipids in macrophages within multiple tissues when a high-fat diet is administered [41]. Although the role of ABCG1 in cholesterol efflux from macrophages is well recognized, its participation to lipid removal from ECs is not established [42,43]. Whether uraemia modulates ABCG1 expression in macrophages or other cell types is presently unknown.

ABCA1 is a membrane-associated protein that plays a crucial role in the cellular apolipoprotein-mediated lipid removal pathway [44]. In humans, homozygous mutations cause Tangier's disease [44], a condition associated with extremely low high-density lipoprotein (HDL) levels, high triglycerides (TG) and a 6-fold increase in the prevalence of cardiovascular disease. In a large cohort of patients [45] and in two smaller observational studies [46,47], heterozygosity for ABCA1 mutations was associated with an increase in risk of ischemic heart disease, low HDLs and high TG. Interestingly, patients suffering from CRF often exhibit a similar pro-atherogenic phenotype.

Many risk factors for ASO such as increased glucose levels [13], age [14] and oxLDLs [12] have pro-apoptotic effects on ECs. Apoptosis of ECs, in turn, is associated with endothelial dysfunction [48] and is believed to play a role in the development of ASO [49,50]. We speculated that uraemic plasma, by down-regulating cholesterol efflux mechanisms in HCAEC, would make these cells more susceptible to apoptosis, especially in the presence of oxLDLs. We observed an increase in apoptotic cell death when HCAECs were exposed to uraemic plasma. Apoptosis was further enhanced when we added oxLDLs to uraemic plasma. Although this is a novel finding, it is consistent with other recent indirect evidence. For instance, urea-carbamylated LDLs, which are high in patients with CRF, can induce apoptosis in HCAECs [51]. Whether the higher levels of apoptosis we observed result from intracellular lipid accumulation due to ABCA1 and ABCG1 down-regulation remains speculative and further studies will be needed to address this issue. However, our results provide evidence that a uraemic environment promotes EC apoptosis, which can lead to the development of ASO and its clinical manifestations. Furthermore, the elevated levels of oxLDLs that are frequently encountered in patients with CRF [52] can enhance EC apoptosis and CVD development.

In conditions promoting endothelial injury and apoptosis, the endothelial layer should have an intact repair capacity to maintain integrity and function. A decrease in this capacity may lead to ASO and its clinical manifestations. Although the repair capacity of resident ECs is hard to quantify in vivo, our results suggest that uraemia diminishes it. We observed a down-regulation of several genes involved in cell-cycle progression in uraemic conditions. CDK-1 is a cyclin-dependent kinase that forms a complex with cyclin B. This complex, M-Cdk, plays a crucial role in the early stages of mitosis by phosphorylating multiple regulatory and structural proteins [53]. The M-Cdk complex induces the assembly of the mitotic spindle and ensures proper chromosomal attachment to the spindle. Furthermore, it is involved in chromosome condensation, nuclear membrane disruption, and actin cytoskeleton rearrangement. Topoisomerase II is a nuclear enzyme involved in chromosome condensation, chromatid separation, and the relief of torsional stress that occurs during DNA transcription and replication [53]. The expression of topoisomerase II is cell-cycle dependent with both protein levels and catalytic activity peaking at G2/M [54]. It serves as a cell proliferation marker in various tumor types [39,40]. Finally, CDCA1 is a protein involved in the attachment of kinetochores to microtubules. Its experimental depletion in HeLa cells has been shown to induce a cell-cycle block and the death of mitotic cells [55].

In agreement with the gene pattern we defined, we observed decreased cell proliferation when HCAECs were exposed to uraemic conditions. Also consistent with our findings, the uraemic solutes P-cresol and indoxyl sulfate have been reported to decrease endothelial wound repair in HUVECs, while P-cresol decreases cell proliferation [56]. Furthermore, asymmetrical dimethylarginine (ADMA) accelerates endothelial senescence [57] and uraemic levels of oxalic acid decreased EC proliferation and migration in HUVECs [58,59]. ADMA is elevated in patients with renal failure, and constitutes an independent risk factor for cardiovascular events in these patients, as well as in the general population [60].

The present study has some limitations. In the microarray experiments, all our uraemic subjects had prior vascular disease and were older than controls. Therefore, we could not study distinct gene expression profiles in the plasma of those with and without CVD. Hence, we cannot rule out the possibility that gene expression changes in HCAECs are induced from solutes being present in the plasma as a result of vascular disease, age or medication rather than as a result of uraemia per se. However, we did perform validating functional assays (cell proliferation and apoptosis assays) on uraemic subjects who were matched for gender and age with their respective controls, which makes it unlikely for these two factors to explain our results. Although the real-time PCR validation studies were performed on the same RNA material as the microarray experiments, we did not have access to sufficient patient plasma from the original sample to perform the cell proliferation and apoptosis assays. We used new experimental subjects for the latter part. However, the fact that the functional assays support our previous findings even when plasma from different patients are used adds robustness to our results.

In conclusion, we found that exposure to uraemic plasma is associated with a down-regulation of genes involved in cholesterol transport and may create conditions that promote EC apoptosis and injury, a phenomenon that is accentuated by the presence of oxLDLs. Exposure to uraemic plasma is also associated with a down-regulation of genes involved in cell-cycle progression and decreased EC proliferation. Our results suggest that the combined effect of uraemia on apoptosis and proliferation of HCAECs can make the endothelial layer dysfunctional and pro-atherogenic in patients with CRF. Taken together, these observations provide novel insights into the pathogenesis of ASO associated with uraemia.

Conflict of interest statement. None declared.



   Acknowledgements
Top
 Abstract
 Introduction
 Subjects and methods
 Results
 Discussion
 Acknowledgements
References
 
The results presented in this article have not been published previously in whole or part, except in abstract format (JASN, 16:90A, 2005). The authors would like to thank Dr Robert Sladek for his assistance in the analysis of the microarray data as well as for his careful revision of the manuscript. We would also like to thank Dr James Brophy for his help in the study design and preparation of the manuscript. This study was funded by Fonds de Recherche en Santé du Québec and McGill University.



   References
Top
 Abstract
 Introduction
 Subjects and methods
 Results
 Discussion
 Acknowledgements
 References
 

  1. Endemann DH and Schiffrin EL. (2004) Endothelial dysfunction. J Am Soc Nephrol 15:1983–1992.[Abstract/Free Full Text]
  2. Shimokawa H. (1999) Primary endothelial dysfunction: atherosclerosis. J Mol Cell Cardiol 31:23–37.[CrossRef][Web of Science][Medline]
  3. Vita JA. (2005) Endothelial function and clinical outcome. Heart 91:1278–1279.[Free Full Text]
  4. Brunner H, Cockcroft JR, Deanfield J, et al. (2005) Endothelial function and dysfunction. Part II: Association with cardiovascular risk factors and diseases. A statement by the Working Group on Endothelins and Endothelial Factors of the European Society of Hypertension. J Hypertens 23:233–246.[CrossRef][Web of Science][Medline]
  5. Widlansky ME, Gokce N, Keaney JF Jr, Vita JA. (2003) The clinical implications of endothelial dysfunction. J Am Coll.Cardiol 42:1149–1160.[Abstract/Free Full Text]
  6. Landmesser U, Hornig B, Drexler H. (2004) Endothelial function: a critical determinant in atherosclerosis? Circulation 109:II27–II33.
  7. Keaney JF Jr. (2000) Atherosclerosis: from lesion formation to plaque activation and endothelial dysfunction. Mol Aspects Med 21:99–166.[CrossRef][Medline]
  8. Vogel RA. (1997) Coronary risk factors, endothelial function, and atherosclerosis: a review. Clin Cardiol 20:426–432.[Web of Science][Medline]
  9. Hackam DG and Anand SS. (2003) Emerging risk factors for atherosclerotic vascular disease: a critical review of the evidence. JAMA 290:932–940.[Abstract/Free Full Text]
  10. Madore F. (2003) Uremia-related metabolic cardiac risk factors in chronic kidney disease. Semin Dial 16:148–156.[CrossRef][Web of Science][Medline]
  11. Wilson PW. (2004) Assessing coronary heart disease risk with traditional and novel risk factors. Clin Cardiol 27:III7–III11.[Medline]
  12. Dimmeler S, Haendeler J, Galle J, Zeiher AM. (1997) Oxidized low-density lipoprotein induces apoptosis of human endothelial cells by activation of CPP32-like proteases. A mechanistic clue to the ‘response to injury’ hypothesis. Circulation 95:1760–1763.
  13. Baumgartner-Parzer SM, Wagner L, Pettermann M, et al. (1995) High-glucose-triggered apoptosis in cultured endothelial cells. Diabetes 44:1323–1327.[Abstract]
  14. Hoffmann J, Haendeler J, Aicher A, et al. (2001) Aging enhances the sensitivity of endothelial cells toward apoptotic stimuli: Important role of nitric oxide. Circ Res 89:709–715.[Abstract/Free Full Text]
  15. Bombeli T, Karsan A, Tait JF, Harlan JM. (1997) Apoptotic vascular endothelial cells become procoagulant. Blood 89:2429–2442.[Abstract/Free Full Text]
  16. Greeno EW, Bach RR, Moldow CF. (1996) Apoptosis is associated with increased cell surface tissue factor procoagulant activity. Lab Invest 75:281–289.[Web of Science][Medline]
  17. Hebert MJ, Gullans SR, Mackenzie HS, Brady HR. (1998) Apoptosis of endothelial cells is associated with paracrine induction of adhesion molecules: evidence for an interleukin-1beta-dependent paracrine loop. Am J Pathol 152:523–532.[Abstract]
  18. Schwartz BR, Karsan A, Bombeli T, Harlan JM. (1999) A novel beta 1 integrin-dependent mechanism of leukocyte adherence to apoptotic cells. J Immunol 162:4842–4848.[Abstract/Free Full Text]
  19. Raymond MA, Desormeaux A, Laplante P, et al. (2004) Apoptosis of endothelial cells triggers a caspase-dependent anti-apoptotic paracrine loop active on VSMC. FASEB J 18:705–707.[Abstract/Free Full Text]
  20. Bochaton-Piallat ML, Gabbiani F, Redard M, Desmouliere A, Gabbiani G. (1995) Apoptosis participates in cellularity regulation during rat aortic intimal thickening. Am J Pathol 146:1059–1064.[Abstract]
  21. Collins AJ, Li S, Ma JZ, Herzog C. (2001) Cardiovascular disease in end-stage renal disease patients. Am J Kidney Dis 38:S26–S29.[Web of Science][Medline]
  22. Cheung AK, Sarnak MJ, Yan G, et al. (2000) Atherosclerotic cardiovascular disease risks in chronic hemodialysis patients. Kidney Int 58:353–362.[CrossRef][Web of Science][Medline]
  23. Xue JL, Frazier ET, Herzog CA, Collins AJ. (2005) Association of heart disease with diabetes and hypertension in patients with ESRD. Am J Kidney Dis 45:316–323.[CrossRef][Web of Science][Medline]
  24. Go AS, Chertow GM, Fan D, McCulloch CE, Hsu CY. (2004) Chronic kidney disease and the risks of death, cardiovascular events, and hospitalization. N Engl J Med 351:1296–1305.[Abstract/Free Full Text]
  25. Ghiadoni L, Cupisti A, Huang Y, et al. (2004) Endothelial dysfunction and oxidative stress in chronic renal failure. J Nephrol 17:512–519.[Web of Science][Medline]
  26. Mittermayer F, Schaller G, Pleiner J, et al. (2005) Asymmetrical dimethylarginine plasma concentrations are related to basal nitric oxide release but not endothelium-dependent vasodilation of resistance arteries in peritoneal dialysis patients. J Am Soc Nephrol 16:1832–1838.[Abstract/Free Full Text]
  27. Passauer J, Bussemaker E, Range U, Plug M, Gross P. (2000) Evidence in vivo showing increase of baseline nitric oxide generation and impairment of endothelium-dependent vasodilation in normotensive patients on chronic hemodialysis. J Am Soc Nephrol 11:1726–1734.[Abstract/Free Full Text]
  28. Pannier B, Guerin AP, Marchais SJ, et al. (2000) Postischemic vasodilation, endothelial activation, and cardiovascular remodeling in end-stage renal disease. Kidney Int 57:1091–1099.[CrossRef][Web of Science][Medline]
  29. London GM, Pannier B, Agharazii M, et al. (2004) Forearm reactive hyperemia and mortality in end-stage renal disease. Kidney Int 65:700–704.[CrossRef][Web of Science][Medline]
  30. Virdis A, Ghiadoni L, Cardinal H, et al. (2001) Mechanisms responsible for endothelial dysfunction induced by fasting hyperhomocystinemia in normotensive subjects and patients with essential hypertension. J Am Coll Cardiol 38:1106–1115.[Abstract/Free Full Text]
  31. Wautier JL, Zoukourian C, Chappey O, et al. (1996) Receptor-mediated endothelial cell dysfunction in diabetic vasculopathy. Soluble receptor for advanced glycation end products blocks hyperpermeability in diabetic rats. J Clin Invest 97:238–243.[Web of Science][Medline]
  32. Sengoelge G, Fodinger M, Skoupy S, et al. (1998) Endothelial cell adhesion molecule and PMNL response to inflammatory stimuli and AGE-modified fibronectin. Kidney Int 54:1637–1651.[CrossRef][Web of Science][Medline]
  33. Werner N, Kosiol S, Schiegl T, et al. (2005) Circulating endothelial progenitor cells and cardiovascular outcomes. N Engl J Med 353:999–1007.[Abstract/Free Full Text]
  34. Raymond MA, Vigneault N, Luyckx V, Hebert MJ. (2002) Paracrine repercussions of preconditioning on angiogenesis and apoptosis of endothelial cells. Biochem Biophys Res Commun 291:261–269.[CrossRef][Web of Science][Medline]
  35. Raymond MA, Desormeaux A, Labelle A, et al. (2005) Endothelial stress induces the release of vitamin D-binding protein, a novel growth factor. Biochem Biophys Res Commun 338:1374–1382.[CrossRef][Web of Science][Medline]
  36. Raymond MA, Mollica L, Vigneault N, et al. (2003) Blockade of the apoptotic machinery by cyclosporin A redirects cell death toward necrosis in arterial endothelial cells: regulation by reactive oxygen species and cathepsin D. FASEB J 17:515–517.[Abstract/Free Full Text]
  37. Irizarry RA, Bolstad BM, Collin F, et al. (2003) Summaries of Affymetrix GeneChip probe level data. Nucleic Acids Res 31:e15.[Abstract/Free Full Text]
  38. Liu G, Loraine AE, Shigeta R, et al. (2003) NetAffx: Affymetrix probesets and annotations. Nucleic Acids Res 31:82–86.[Abstract/Free Full Text]
  39. Preusser M, Wolfsberger S, Czech T, et al. (2005) Survivin expression in intracranial ependymomas and its correlation with tumor cell proliferation and patient outcome. Am J Clin Pathol 124:1–7.[CrossRef]
  40. Arpino G, Ciocca DR, Weiss H, et al. (2005) Predictive value of apoptosis, proliferation, HER-2, and topoisomerase IIalpha for anthracycline chemotherapy in locally advanced breast cancer. Breast Cancer Res Treat 92:69–75.[CrossRef][Web of Science][Medline]
  41. Kennedy MA, Barrera GC, Nakamura K, et al. (2005) ABCG1 has a critical role in mediating cholesterol efflux to HDL and preventing cellular lipid accumulation. Cell Metab 1:121–131.[CrossRef][Web of Science][Medline]
  42. O’Connell BJ, Denis M, Genest J. (2004) Cellular physiology of cholesterol efflux in vascular endothelial cells. Circulation 110:2881–2888.
  43. Hoekstra M, Kruijt JK, Van Eck M, Van Berkel TJ. (2003) Specific gene expression of ATP-binding cassette transporters and nuclear hormone receptors in rat liver parenchymal, endothelial, and Kupffer cells. J Biol Chem 278:25448–25453.[Abstract/Free Full Text]
  44. Lawn RM, Wade DP, Garvin MR, et al. (1999) The Tangier disease gene product ABC1 controls the cellular apolipoprotein-mediated lipid removal pathway. J Clin Invest 104:R25–R31.[Web of Science][Medline]
  45. Frikke-Schmidt R, Nordestgaard BG, Schnohr P, Steffensen R, Tybjaerg-Hansen A. (2005) Mutation in ABCA1 predicted risk of ischemic heart disease in the Copenhagen City Heart Study Population. J Am Coll Cardiol 46:1516–1520.[Abstract/Free Full Text]
  46. van Dam MJ, de Groot E, Clee SM, et al. (2002) Association between increased arterial-wall thickness and impairment in ABCA1-driven cholesterol efflux: an observational study. Lancet 359:37–42.[CrossRef][Web of Science][Medline]
  47. Clee SM, Kastelein JJ, van Dam M, et al. (2000) Age and residual cholesterol efflux affect HDL cholesterol levels and coronary artery disease in ABCA1 heterozygotes. J Clin Invest 106:1263–1270.[Web of Science][Medline]
  48. Asai K, Kudej RK, Shen YT, et al. (2000) Peripheral vascular endothelial dysfunction and apoptosis in old monkeys. Arterioscler Thromb Vasc Biol 20:1493–1499.[Abstract/Free Full Text]
  49. Choy JC, Granville DJ, Hunt DW, McManus BM. (2001) Endothelial cell apoptosis: biochemical characteristics and potential implications for atherosclerosis. J Mol Cell Cardiol 33:1673–1690.[CrossRef][Web of Science][Medline]
  50. Tricot O, Mallat Z, Heymes C, et al. (2000) Relation between endothelial cell apoptosis and blood flow direction in human atherosclerotic plaques. Circulation 101:2450–2453.
  51. Ok E, Basnakian AG, Apostolov EO, Barri YM, Shah SV. (2005) Carbamylated low-density lipoprotein induces death of endothelial cells: a link to atherosclerosis in patients with kidney disease. Kidney Int 68:173–178.[CrossRef][Web of Science][Medline]
  52. Maggi E, Bellazzi R, Gazo A, Seccia M, Bellomo G. (1994) Autoantibodies against oxidatively-modified LDL in uremic patients undergoing dialysis. Kidney Int 46:869–876.[Web of Science][Medline]
  53. Alberts B, Johnson A, Lewis J, et al. (2002) Molecular Biology of the Cell(Garland Publisher, New York) pp. 983–1026.
  54. Larsen AK, Skladanowski A, Bojanowski K. (1996) The roles of DNA topoisomerase II during the cell cycle. Prog Cell Cycle Res 2:229–239.[Medline]
  55. DeLuca JG, Moree B, Hickey JM, Kilmartin JV, Salmon ED. (2002) hNuf2 inhibition blocks stable kinetochore-microtubule attachment and induces mitotic cell death in HeLa cells. J Cell Biol 159:549–555.[Abstract/Free Full Text]
  56. Dou L, Bertrand E, Cerini C, et al. (2004) The uremic solutes p-cresol and indoxyl sulfate inhibit endothelial proliferation and wound repair. Kidney Int 65:442–451.[CrossRef][Web of Science][Medline]
  57. Scalera F, Borlak J, Beckmann B, et al. (2004) Endogenous nitric oxide synthesis inhibitor asymmetric dimethyl L-arginine accelerates endothelial cell senescence. Arterioscler Thromb Vasc Biol 24:1816–1822.[Abstract/Free Full Text]
  58. Recht PA, Tepedino GJ, Siecke NW, et al. (2004) Oxalic acid alters intracellular calcium in endothelial cells. Atherosclerosis 173:321–328.[Web of Science][Medline]
  59. Levin RI, Kantoff PW, Jaffe EA. (1990) Uremic levels of oxalic acid suppress replication and migration of human endothelial cells. Arteriosclerosis 10:198–207.[Abstract/Free Full Text]
  60. Kielstein JT and Zoccali C. (2005) Asymmetric dimethylarginine: a cardiovascular risk factor and a uremic toxin coming of age? Am J Kidney Dis 46:186–202.[CrossRef][Web of Science][Medline]
Received for publication: 22. 4.06
Accepted in revised form: 26. 9.06


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?



This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
22/2/409    most recent
gfl619v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (1)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Cardinal, H.
Right arrow Articles by Madore, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cardinal, H.
Right arrow Articles by Madore, F.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?