Skip Navigation


NDT Advance Access originally published online on July 28, 2006
Nephrology Dialysis Transplantation 2006 21(11):3122-3126; doi:10.1093/ndt/gfl434
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
21/11/3122    most recent
gfl434v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Caramori, M. L.
Right arrow Articles by Mauer, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Caramori, M. L.
Right arrow Articles by Mauer, M.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author [2006]. Published by Oxford University Press on behalf of ERA-EDTA. All rights reserved. For Permissions, please email: journals.permissions@oxfordjournals.org

Cellular basis of diabetic nephropathy: IV Antioxidant enzyme mRNA expression levels in skin fibroblasts of type 1 diabetic sibling pairs

Maria Luiza Caramori1,2, Youngki Kim1, Paola Fioretto3, Chunmei Huang1, Stephen S. Rich4, Michael E. Miller4, Gregory B. Russell4 and Michael Mauer1

1Department of Pediatrics and 2Department of Medicine, University of Minnesota, Minnesota, USA, 3Department of Medical and Surgical Sciences, University of Padova, Italy and 4Department of Public Health Sciences, Wake Forest School of Medicine, North Carolina, USA

Correspondence and offprint requests to: Michael Mauer, M.D. 420 Delaware Street S.E, Mayo Mail Code 491, Minneapolis, MN 55455, USA. Email: mauer002{at}umn.edu



   Abstract
Top
 Abstract
Introduction
 Subjects and methods
 Results
 Discussion
 Acknowledgements
 References
 
Background. Blunted cultured skin fibroblast (SF) antioxidant enzyme responses to hyperglycaemia are associated with diabetic nephropathy risk. The present study explores whether this association is, at least in part, genetically determined.

Methods. We measured glomerular structure and SF mRNA expression for catalase and glutathione peroxidase in 21 sibling pairs concordant for type 1 diabetes. All patients had four or more (mean 21.5) years of diabetes and glomerular filtration rate >40 ml/min/1.73 m2. Thirty-four patients were normoalbuminuric, four were microalbuminuric, three were proteinuric and one was not classifiable. Heritability of patient characteristics was assessed by intra-class correlation and by a genetic variance component model.

Results. Mesangial fractional volume, mesangial matrix fractional volume, glomerular basement membrane width and surface density of peripheral glomerular basement membrane per glomerulus were significantly correlated in these sibling pairs. Catalase mRNA expression levels were also related and highly heritable in these sibling pairs. The association between sibship and glutathione peroxidase mRNA expression levels did not reach statistical significance.

Conclusions. This study suggests that SF catalase mRNA expression levels, known to be associated with diabetic nephropathy risk, are in part genetically determined.

Keywords: genetics of diabetic nephropathy; glomerular structure; type 1 diabetes



   Introduction
Top
 Abstract
 Introduction
Subjects and methods
 Results
 Discussion
 Acknowledgements
 References
 
Family studies have shown strong concordance for diabetic nephropathy (DN) risk in type 1 and type 2 diabetes [1–5]. This suggests that DN risk, although related to glycaemia [6], is substantially genetically determined [3,7,8]. Skin fibroblast (SF) behaviours after multiple in vitro passages are associated with DN risk [9–11]. Moreover, sodium/hydrogen exchanger isoform 1 (NHE-1) activity [12] is concordant in type 1 diabetic sibling pairs who are concordant for DN lesions [13].

Oxidative stress has been linked to the pathogenesis of the ß-cell destruction involved in the initiation of type 1 diabetes [14–17]. The idea tested here that antioxidant responses are, at least in part, inherited, derive from studies showing increased oxidative stress in non-diabetic relatives of type 1 diabetic patients [18]. It is also known that there are differences in antioxidant enzyme activity among different races. Both lower activity [19] and increased DN risk [20,21] are present in African patients. Oxidative stress has also been implicated in the pathogenesis of DN [22]. When grown in high as compared with normal glucose conditions, SF from type 1 diabetic patients with DN showed a marked impairment in the expected increases in mRNA expression, protein and activity levels for catalase and glutathione peroxidase [23]. Thus, SF of type 1 diabetic subjects with DN have a blunted antioxidant enzyme response and increased oxidative stress on exposure to high glucose [23]. These results were largely confirmed by Chiarelli et al. [24]. Moreover, the parallel findings for catalase and glutathione peroxidase mRNA expression levels in monocytes from type 1 diabetic patients [25] and in erythrocytes from type 2 diabetic patients [26] suggest that these phenomena might be widespread among different cell types.

We reported strong familial concordance for DN lesions and patterns of lesions among largely normoalbuminuric type 1 diabetic sibling pairs [13]. We have also used the type 1 diabetic sibling pair model to study the familial relationships of SF sodium-hydrogen (Na+/H+) antiport activity [12], a marker associated with DN risk [9,10,27]. Using this model, we demonstrated concordance in this SF behaviour between sibling pairs concordant for type 1 diabetes and concluded that, there was at least in part, genetic regulation of this cellular activity in association with DN risk [12]. Herein we studied mRNA expression for catalase and glutathione peroxidase in type 1 diabetic sibling pairs to determine whether variations in antioxidant enzyme mRNA levels are genetically regulated.



   Subjects and methods
Top
 Abstract
 Introduction
 Subjects and methods
Results
 Discussion
 Acknowledgements
 References
 
Patients
Twenty-one type 1 diabetic sibling pairs had research renal biopsies and renal function studies in the University of Minnesota (U of MN) General Clinical Research Center (GCRC). They all had at least 4 years of diabetes, serum creatinine ≤2.0 mg/dl, glomerular filtration rate (GFR) >40 ml/min/1.73 m2 and no other kidney disease. Thirty-four (80%) had no clinical or laboratory evidence of renal disease (see subsequently). Studies were approved by the committee for the use of human subjects in research of the U of MN and prior informed consent was always obtained. Glomerular structural parameters of 17 [13] and SF Na+/H+ antiport activity of 14 [12] of these sibling pairs have been reported.

Clinical studies
Blood pressure (BP) was measured with an oscillometric monitor as described [28]. Hypertension was defined as BP ≥130/85 mmHg [29,30] or use of antihypertensive drugs. Glycated haemoglobin (HbA1c) was measured by HPLC, serum and urinary creatinine by the Jaffe's reaction and albumin excretion rate (AER) by a fluorimetric assay [31] in three 24-h urine collections. Patients were classified as normoalbuminuric (AER <20 µg/min), microalbuminuric (AER 20–200 µg/min) or proteinuric (AER >200 µg/min) [31]. Patients who were microalbuminuric or proteinuric before antihypertensive treatment were classified according to their pre-treatment AER values. GFR was estimated by the mean of three 24-h creatinine clearances which are highly correlated (R = 0.92; P < 0.001) with inulin clearances performed during the same GCRC admission [32]. Retinopathy was assessed by fundoscopy [31].

Renal morphometric analyses
Glomerular basement membrane (GBM) width [33], mesangial, mesangial matrix and mesangial cell fractional volumes [Vv(Mes/glom), Vv(MM/glom) and Vv(MC/glom), respectively] [31,34,35], and surface density of the peripheral GBM [Sv(PGBM/glom)] [31,33] were measured as detailed elsewhere. Reference ranges for glomerular structural parameters were derived from 76 normal living kidney transplant donors [33 males; age 37.6 ± 12.1 (19–64) years].

Cellular studies
Skin biopsy and cell culture
Skin tissue was obtained with a 3 mm punch at the kidney biopsy site and processed as detailed elsewhere [11].

RNA isolation
The modified single-step isolation method [36] was used to extract SF total RNA and the quantity and quality determined as described [11]. No samples required exclusion for RNA degradation. Total RNA was adjusted to 0.05 g/L and aliquots frozen at –70°C in RNA Storage Solution (Ambion Inc, Austin, Texas) containing 20 U/µl of SUPERase In® (Ambion Inc, Austin, Texas) until assayed. Pooled total RNA from SF of six normal subjects was the ‘reference’ standard. A set of eight 2-fold serial dilutions of the 0.4 ng/ml RNA standard was prepared and stored in aliquots at –70°C until used.

Quantitation of unknown samples by real-time reverse transcriptase polymerase chain reaction (RT–PCR)
The primers and the Taqman fluorogenic probe were designed using PE Primer Express Version 1.5 software to produce an amplicon spanning an intron. TTCAACACTGCCAATGATGAT was the forward primer, CCTCATTCAGCACGTTCACA was the reverse primer and TTGAAGATGCGGCGAGACTTTCCC was the probe for catalase. ACCGCGCTTATGACCGAC, GGCAACATCGTTGCGACA and CCAAGCTCATCACCTGGTCTCCGG were the forward primer, reverse primer and probe for glutathione peroxidase, respectively. The assay was carried out as described [11]. cRNA standards were run in triplicate, on separate days, simultaneously with the unknown samples. The correlation coefficients (R) of the standard curves were greater than 0.98; within run variability was 9.1%. The non-template RNA controls were run for each gene. No amplicons were detected in these controls. The relative value of target mRNA in 0.1 µg of unknown total mRNA sample was expressed as fold change based on the concentration of target mRNA in 0.1 µg of the reference total mRNA.

Statistical analyses
Data are presented as mean ± SD or median (range). AER values were log transformed before analysis. Mixed models were used to estimate the intra-class correlation (R) for the structural renal parameters and SF catalase and glutathione peroxidase mRNA expression within sibling pairs. Since siblings are often of similar age and diabetes duration, the effects of age, age2, duration and duration2 were entered into a mixed effects ANOVA.

To determine the contribution of genetic factors on variation in the SF catalase and glutathione peroxidase mRNA expression levels, we constructed nuclear families from the sibling pair data and performed genetic variance component analyses using the SOLAR software package (Southwest Foundation for Biomedical Research, San Antonio, TX) [37]. SOLAR performs an analysis of family data that decomposes the total variance of the phenotype (SF catalase and glutathione peroxidase mRNA expression level) into components that are due to genetic (polygenic) effects (estimating the additive genetic variance), measured covariates and random (unmeasured) environmental effects. The relative contribution of genetic factors to each phenotype is then determined by the heritability (h2), defined by the ratio of additive genetic variance to the residual phenotypic variance (after the removal of covariates). Thus h2 is presented as the percentage of the variability in mRNA expression levels (mean ± SE) that is explained by genetic factors. A series of models were developed that incorporates covariates in a hierarchical manner. The first model contained no covariates. The final model was adjusted for covariates that were significantly associated with catalase or glutathione peroxidase levels. Significance of the heritability estimates was determined by a likelihood ratio test, in which the likelihood of the models with an additive genetic variance component and covariates was compared with the likelihood of a model with the additive genetic variance component constrained to zero.



   Results
Top
 Abstract
 Introduction
 Subjects and methods
 Results
Discussion
 Acknowledgements
 References
 
The 42 diabetic patients (25 females) were 38.1 ± 7.9 years old, 15.9 ± 9.0 years old at diabetes onset and had diabetes for 21.5 ± 10.6 years. HbA1c at biopsy was 8.4 ± 1.2%. AER was 6.6 (1.0–860) µg/min; 34 patients were normoalbuminuric, four were microalbuminuric, three were proteinuric and one was unclassifiable. GFR ranged from 46 to 162 ml/min/1.73 m2. Retinopathy was present in 13 patients (31%) and eight (19%) had proliferative changes. Hypertension was present in 11 patients (26%), six (14%) were on antihypertensive drugs, three (7%) of them were on angiotensin converting enzyme inhibitors or angiotensin II type 1-receptor blockers.

GBM width, Vv(Mes/glom) and Vv(MM/glom) were increased, while Sv(PGBM/glom) was decreased in these patients compared with controls (Table 1). As expected from our earlier report [13] and the partial overlap in the patient populations, GBM width (R = 0.50; P = 0.014), Vv(Mes/glom) (R = 0.62; P = 0.001), Vv(MM/glom) (R = 0.63; P = 0.001) and Sv(PGBM/glom) (R = 0.80; P = 0.001) were correlated among the sibling pairs, and this was independent of age and diabetes duration (data not shown).


View this table:
[in this window]
[in a new window]

  		Table 1. Glomerular structural parameter in the 42 diabetic patients and in 76 non-diabetic controls

 
The intraclass correlation between the sibling pairs was R = 0.38 (P = 0.076; Figure 1) for catalase mRNA expression levels and R = 0.31 (P = 0.140; Figure 2) for glutathione peroxidase. Using the variance component analyses model without covariates, the estimated heritability for catalase mRNA expression levels was h2 = 0.78 ± 0.45 (P = 0.06). After adjustment for sex and HbA1c, the residual heritability was h2 = 0.69 ± 0.46 (P = 0.04). Glutathione peroxidase mRNA levels did not show a significant heritability component before (h2 = 0.47 ± 0.46; P = 0.16) or after (h2 = 0.24 ± 0.52; P = 0.32) adjustment for age at diabetes onset.


Figure 1
View larger version (9K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 1. Skin fibroblast mRNA expression of catalase in 21 sibling pairs with type 1 diabetes. Pairs are linked by the vertical lines and ordered by the mean catalase mRNA expression levels of each pair.

 

Figure 2
View larger version (8K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 2. SF mRNA expression of glutathione peroxidase in 21 sibling pairs with type 1 diabetes. Pairs are linked by the vertical lines and ordered by the mean glutathione mRNA expression levels of each pair.

 


   Discussion
Top
 Abstract
 Introduction
 Subjects and methods
 Results
 Discussion
Acknowledgements
 References
 
The present work supports the concept that the behaviour of cells studied after several passages in vitro, at least in part, reflects their genetic background. The association between SF behaviours and DN risk was first reported in regards to (NHE-1) activity [9,10]. Subsequently, with similar numbers of subjects, we showed that type 1 diabetic siblings concordant for DN lesions [13] and for DN risk [1,3,4] were also concordant for NHE-1 activity [12] and concluded that this was likely, to a large extent, substantially genetically determined.

Ceriello et al. [23] demonstrated similar directions for SF message, protein and activity levels for catalase and glutathione peroxidase in response to high glucose, and established that lesser increases were related to increased DN risk. The findings for SF antioxidant enzymes mRNA, protein and activity levels were subsequently confirmed by Chiarelli et al. [24]. Parallel findings in antioxidant enzyme gene expression levels were found in cultured monocytes from type 1 diabetic patients with and without DN [25], strongly confirming the original observation and suggesting that this blunted cell response in DN patients could be present in multiple cell types. The present study was not designed to retest these well-established associations between in vitro cellular enzyme systems and DN risk, but rather focused on the question of whether these phenomena could, at least in part, be due to a heritable component in the antioxidant cellular phenotype among type 1 diabetic sibling pairs. The concordance for antioxidant enzyme mRNA levels in sibling pairs is concordant with at least partial genetic determination of these levels.

Oxidative stress may lead to extracellular matrix accumulation, as elegantly hypothesized by others [22,38,39]. Moreover, it was recently shown that glutathione content correlated with Na+/H+ exchanger (NHE) activity in erythrocytes [40], linking oxidative stress to an ion-transport system, associated with DN risk. Further, in vitro exposure of cardiac myocytes to hydrogen peroxide (H2O2) resulted in sustained mitogen-activated protein kinase (MAPK) activation and increased NHE-1 activity [41]. Interestingly, catalase completely inhibited MAPK activation by H2O2 in these cells [41]. Inadequate cellular antioxidant enzyme responses to high glucose could contribute to free radicals accumulation, which, in turn, could increase NHE activity. The results of the present and previous [18,41] work suggest that the increased in vitro NHE-1 activity seen in cells from DN patients could be the downstream consequence of oxidative stress induced by hyperglycaemia.

The failure to find SF glutathione peroxidase mRNA levels heritability might have resulted from technical and/or sample size factors. The range of glutathione peroxidase mRNA expression levels in this study was narrower than that of catalase, perhaps making concordance harder to detect. Since it is unlikely that individuals with genetic predisposition to or protection from DN would inherit multiple defects in the antioxidant enzyme system, upstream genes that regulate both catalase and glutathione peroxidase and other enzymes in this system would be good candidates for study. For example, the lower catalase and glutathione peroxidase mRNA expression levels seen in monocytes cultured under high vs normal glucose conditions in patients with DN were associated with aldose reductase genotype and mRNA levels [25], and responsiveness to high glucose was partially normalized by an aldose reductase inhibitor [25]. Thus, further exploration of genes related to the regulation of antioxidant enzymes could lead to new insights in this area.

The current study was limited in its power to evaluate the relationships between mRNA expression levels of antioxidant enzymes and renal function. These siblings, to avoid bias, were not selected for the presence of complications. Thus, since most type 1 diabetic patients are not at risk of DN, sibling pairs in this unselected series were predominantly normoalbumunic and had normal GFR. This made the range of AER and GFR too narrow to explore the correlations between these parameters and mRNA expression levels for catalase and glutathione peroxidase. It would be of interest to design sibling pair studies where the associations between expression and activity of these enzymes and relevant pathways, renal structure and function could be tested.



   Acknowledgements
Top
 Abstract
 Introduction
 Subjects and methods
 Results
 Discussion
 Acknowledgements
References
 
Dr Caramori was supported by the Foundation for the Coordination of Higher Education and Graduate Training (CAPES) from the Brazilian Government and by a Research Fellowship grant from the Juvenile Diabetes Research Foundation International (JDRFI). Dr Fioretto was a recipient of a JDRFI Research Fellowship grant and Career Development Award. Dr Huang was supported by a mentor-based fellowship grant from the American Diabetes Association. This work was supported by grants from National Institute of Health (DK 13083 and DK 54638) and National Center for Research Resources (M01-RR00400). We thank Mr Thomas Groppoli for performing the morphometric studies and Mr Paul Walker for helping with the RT–PCR studies.

Conflict of interest statement. None declared.



   References
Top
 Abstract
 Introduction
 Subjects and methods
 Results
 Discussion
 Acknowledgements
 References
 

  1. Seaquist ER, Goetz FC, Rich S, et al. (1989) Familial clustering of diabetic kidney disease. Evidence for genetic susceptibility to diabetic nephropathy. N Engl J Med 320:1161–1165.[Abstract]
  2. Pettitt DJ, Saad MF, Bennett PH, et al. (1990) Familial predisposition to renal disease in two generations of Pima Indians with type 2 (non-insulin-dependent) diabetes mellitus. Diabetologia 33:438–443.[CrossRef][ISI][Medline]
  3. Borch-Johnsen K, Norgaard K, Hommel E, et al. (1992) Is diabetic nephropathy an inherited complication? Kidney Int 41:719–722.[ISI][Medline]
  4. Quinn M, Angelico MC, Warram JH, et al. (1996) Familial factors determine the development of diabetic nephropathy in patients with IDDM. Diabetologia 39:940–945.[ISI][Medline]
  5. Satko SG, Langefeld CD, Daeihagh P, et al. (2002) Nephropathy in siblings of African Americans with overt type 2 diabetic nephropathy. Am J Kidney Dis 40:489–494.[CrossRef][ISI][Medline]
  6. The Diabetes Control and Complications Trial Research Group. (1993) The effect of intensive treatment of diabetes on the development and progression of long-term complications in insulin-dependent diabetes mellitus. N Engl J Med 329:977–986.[Abstract/Free Full Text]
  7. Krolewski AS, Warram JH, Rand LI, et al. (1987) Epidemiologic approach to the etiology of type I diabetes mellitus and its complications. N Engl J Med 317:1390–1398.[ISI][Medline]
  8. Krolewski AS. (1999) Genetics of diabetic nephropathy: evidence for major and minor gene effects. Kidney Int 55:1582–1596.[CrossRef][ISI][Medline]
  9. Davies JE, Ng LL, Kofoed-Enevoldsen A, et al. (1992) Intracellular pH and Na+/H+ antiport activity of cultured skin fibroblasts from diabetics. Kidney Int 42:1184–1190.[ISI][Medline]
  10. Lurbe A, Fioretto P, Mauer M, et al. (1996) Growth phenotype of cultured skin fibroblasts from IDDM patients with and without nephropathy and overactivity of the Na+/H+ antiporter. Kidney Int 50:1684–1693.[ISI][Medline]
  11. Huang C, Kim Y, Caramori ML, et al. (2002) Cellular basis of diabetic nephropathy:. II. The transforming growth factor-beta system and diabetic nephropathy lesions in type 1 diabetes. Diabetes 51:3577–3581.[Abstract/Free Full Text]
  12. Trevisan R, Fioretto P, Barbosa J, et al. (1999) Insulin-dependent diabetic sibling pairs are concordant for sodium-hydrogen antiport activity. Kidney Int 55:2383–2389.[CrossRef][ISI][Medline]
  13. Fioretto P, Steffes MW, Barbosa J, et al. (1999) Is diabetic nephropathy inherited? Studies of glomerular structure in type 1 diabetic sibling pairs. Diabetes 48:865–869.[Abstract]
  14. Maechler P, Jornot L, Wollheim CB. (1999) Hydrogen peroxide alters mitochondrial activation and insulin secretion in pancreatic beta cells. J Biol Chem 274:27905–27913.[Abstract/Free Full Text]
  15. Khamaisi M, Kavel O, Rosenstock M, et al. (2000) Effect of inhibition of glutathione synthesis on insulin action: in vivo and in vitro studies using buthionine sulfoximine. Biochem J 349:579–586.[CrossRef][ISI][Medline]
  16. Evans JL, Goldfine ID, Maddux BA, et al. (2003) Are oxidative stress-activated signaling pathways mediators of insulin resistance and beta-cell dysfunction? Diabetes 52:1–8.[Abstract/Free Full Text]
  17. Hoeldtke RD, Bryner KD, McNeill DR, et al. (2003) Oxidative stress and insulin requirements in patients with recent-onset type 1 diabetes. J Clin Endocrinol Metab 88:1624–1628.[Abstract/Free Full Text]
  18. Matteucci E and Giampietro O. (2000) Oxidative stress in families of type 1 diabetic patients. Diabetes Care 23:1182–1186.[Abstract/Free Full Text]
  19. Zitouni K, Nourooz-Zadeh J, Harry D, et al. (2005) Race-specific differences in antioxidant enzyme activity in patients with type 2 diabetes: a potential association with the risk of developing nephropathy. Diabetes Care 28:1698–1703.[Abstract/Free Full Text]
  20. Cowie CC, Port FK, Wolfe RA, et al. (1989) Disparities in incidence of diabetic end-stage renal disease according to race and type of diabetes. N Engl J Med 321:1074–1079.[Abstract]
  21. USRDS 2004 Annual Data Report. (2004) (The National Institutes of Health, National Institute of Diabetes and Digestive and Kidney Diseases, Bethesda, MD).
  22. Baynes JW and Thorpe SR. (1999) Role of oxidative stress in diabetic complications: a new perspective on an old paradigm. Diabetes 48:1–9.[Abstract]
  23. Ceriello A, Morocutti A, Mercuri F, et al. (2000) Defective intracellular antioxidant enzyme production in type 1 diabetic patients with nephropathy. Diabetes 49:2170–2177.[Abstract]
  24. Chiarelli F, Di Marzio D, Santilli F, et al. (2005) Effects of irbesartan on intracellular antioxidant enzyme expression and activity in adolescents and young adults with early diabetic angiopathy. Diabetes Care 28:1690–1697.[Abstract/Free Full Text]
  25. Hodgkinson AD, Bartlett T, Oates PJ, et al. (2003) The response of antioxidant genes to hyperglycemia is abnormal in patients with type 1 diabetes and diabetic nephropathy. Diabetes 52:846–851.[Abstract/Free Full Text]
  26. Bhatia S, Shukla R, Venkata Madhu S, et al. (2003) Antioxidant status, lipid peroxidation and nitric oxide end products in patients of type 2 diabetes mellitus with nephropathy. Clin Biochem 36:557–562.[CrossRef][ISI][Medline]
  27. Trevisan R, Cipollina MR, Duner E, et al. (1996) Abnormal Na+/H+ antiport activity in cultured fibroblasts from NIDDM patients with hypertension and microalbuminuria. Diabetologia 39:717–724.[ISI][Medline]
  28. Caramori ML, Kim Y, Huang C, et al. (2002) Cellular basis of diabetic nephropathy. 1. Study design and renal structural-functional relationships in patients with long-standing type 1 diabetes. Diabetes 51:506–513.[Abstract/Free Full Text]
  29. Bakris GL, Williams M, Dworkin L, et al. (2000) Preserving renal function in adults with hypertension and diabetes: a consensus approach. National Kidney Foundation Hypertension and Diabetes Executive Committees Working Group. Am J Kidney Dis 36:646–661.[ISI][Medline]
  30. Chobanian AV, Bakris GL, Black HR, et al. (2003) The seventh report of the Joint National Committee on Prevention, Detection, Evaluation, and Treatment of High Blood Pressure: the JNC 7 report. JAMA 289:2560–2572.[Abstract/Free Full Text]
  31. Chavers BM, Simonson J, Michael AF. (1984) A solid phase fluorescent immunoassay for the measurement of human urinary albumin. Kidney Int 25:576–578.[ISI][Medline]
  32. Ellis EN, Steffes MW, Goetz FC, et al. (1986) Glomerular filtration surface in type I diabetes mellitus. Kidney Int 29:889–894.[ISI][Medline]
  33. Jensen EB, Gundersen HJ, Osterby R. (1979) Determination of membrane thickness distribution from orthogonal intercepts. J Microsc 115:19–33.[ISI][Medline]
  34. Fioretto P, Steffes MW, Mauer M. (1994) Glomerular structure in nonproteinuric IDDM patients with various levels of albuminuria. Diabetes 43:1358–1364.[Abstract]
  35. Steffes MW, Bilous RW, Sutherland DE, et al. (1992) Cell and matrix components of the glomerular mesangium in type I diabetes. Diabetes 41:679–684.[Abstract]
  36. Chomczynski P and Sacchi N. (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162:156–159.[ISI][Medline]
  37. Almasy L and Blangero J. (1998) Multipoint quantitative-trait linkage analysis in general pedigrees. Am J Hum Genet 62:1198–1211.[CrossRef][ISI][Medline]
  38. Nishikawa T, Edelstein D, Brownlee M. (2000) The missing link: a single unifying mechanism for diabetic complications. Kidney Int 58:[Suppl 77], S26–30.
  39. Brownlee M. (2005) The pathobiology of diabetic complications: a unifying mechanism. Diabetes 54:1615–1625.[Free Full Text]
  40. Matteucci E and Giampietro O. (2001) Oxidative stress in families of type 1 diabetic patients – further evidence. Diabetes Care 24:167–168.[Free Full Text]
  41. Sabri A, Byron KL, Samarel AM, et al. (1998) Hydrogen peroxide activates mitogen-activated protein kinases and Na+–H+ exchange in neonatal rat cardiac myocytes. Circ Res 82:1053–1062.[Abstract/Free Full Text]
Received for publication: 8.12.05
Accepted in revised form: 22. 6.06


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?



This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
21/11/3122    most recent
gfl434v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Caramori, M. L.
Right arrow Articles by Mauer, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Caramori, M. L.
Right arrow Articles by Mauer, M.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?