Skip Navigation


NDT Advance Access originally published online on March 15, 2005
Nephrology Dialysis Transplantation 2005 20(5):902-908; doi:10.1093/ndt/gfh769
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Supplementary data
Right arrow All Versions of this Article:
20/5/902    most recent
gfh769v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (11)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Yu, Z.
Right arrow Articles by Yang, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yu, Z.
Right arrow Articles by Yang, J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author [2005]. Published by Oxford University Press on behalf of ERA-EDTA. All rights reserved. For Permissions, please email: journals.permissions@oupjournals.org


Original Article

Mutations in NPHS2 in sporadic steroid-resistant nephrotic syndrome in Chinese children

Zihua Yu, Jie Ding, Jianping Huang, Yong Yao, Huijie Xiao, Jingjing Zhang, Jingcheng Liu and Jiyun Yang

Department of Pediatrics, Peking University First Hospital, Beijing, P. R. China 100034.

Correspondence and offprint requests to: Jie Ding, Department of Pediatrics, Peking University First Hospital, No. 1 Xi An Men Street, Beijing, P. R. China 100034. Email: jieding{at}public.bta.net.cn



   Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Background. Since the identification of the NPHS2 gene, various investigators have demonstrated that an NPHS2 mutation is a frequent cause of sporadic steroid-resistant nephrotic syndrome (SRNS), and occurs in 10.5–28% of children with the syndrome. Idiopathic nephrotic syndrome (INS) is also the most frequent glomerular disease in Chinese children, of which ~20% of cases show steroid resistance. To our knowledge, however, whether or not NPHS2 is the causative gene in Chinese sporadic SRNS has not been established. This study aims to examine mutations in NPHS2 in Chinese children with sporadic SRNS.

Methods. We examined 23 Chinese children with sporadic SRNS for mutations in NPHS2. The mutational analysis of NPHS2 was performed by polymerase chain reaction, denaturing high-performance liquid chromatography and DNA sequencing.

Results. A heterozygous missense mutation of L361P in exon 8 of NPHS2 was detected in one of 23 children with sporadic SRNS, whereas it was not found in 53 controls. We also identified seven NPHS2 polymorphisms, –51G>T, 288C>T, IVS3-46C>T, IVS3-21C>T, IVS7-74G>C, 954T>C and 1038A>G, in some patients and controls. There was no significant difference in the genotypic and allelic frequencies of these polymorphisms between the patients and controls.

Conclusion. The results demonstrate that NPHS2 mutations are also present in Chinese sporadic SRNS. Our investigation supports the necessity of searching for mutations in NPHS2 in Chinese children with sporadic SRNS.

Keywords: Chinese; NPHS2; steroid-resistant nephrotic syndrome



   Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Idiopathic nephrotic syndrome (INS) is characterized by heavy proteinuria, hypoalbuminaemia, oedema and hyperlipidaemia. It is the most common glomerular disease in childhood. On the basis of the patients' responses to steroid therapy, it is divided into steroid-sensitive nephrotic syndrome (SSNS) and steroid-resistant nephrotic syndrome (SRNS). Most patients respond to steroid therapy and show favourable outcomes; however, 10–20% of patients fail to respond to steroid treatment and may progress to end-stage renal failure [1,2]. Advances in molecular genetics have allowed some investigators during the past few years to suggest that a subset of individuals with SRNS have a primary defect of podocyte proteins—such as podocin, nephrin and {alpha}-actinin 4—in the glomerular filtration barrier [3–5]. Recent studies have demonstrated that mutations in the genes encoding podocyte proteins are responsible for two autosomal recessive SRNS [3,4] and an autosomal dominant focal segmental glomerulosclerosis (FSGS) [5]. Mutations in NPHS2, which was mapped to chromosome 1q25–31 and encodes podocin, cause autosomal recessive SRNS [3]. Another autosomal recessive SRNS (congenital nephrotic syndrome of the Finnish type) is associated with mutations in NPHS1, which encodes nephrin [4]. Mutations in ACTN4, encoding {alpha}-actinin 4, have been identified in familial FSGS with autosomal dominance [5].

Since the identification of the NPHS2 gene, different investigators in Europe, the Middle East and North America have demonstrated that an NPHS2 mutation is a frequent cause of sporadic SRNS, occurring in 10.5–28% of children with sporadic SRNS [1,2,6–9]. An NPHS2 mutation is also responsible for an adult-onset form of FSGS [10]. Those investigators have also concluded that the identification of mutations in the NPHS2 gene may enable clinicians to avoid unnecessary treatments with steroids or other immunosuppressants in SRNS patients and to provide prenatal diagnosis for families at high risk [2,6,7].

INS is also the most frequent glomerular disease in Chinese children, of whom ~20% with INS show steroid resistance, a percentage similar to that found in other countries. To our knowledge, however, whether or not the NPHS2 gene is the causative gene in Chinese sporadic SRNS is not known. We therefore performed mutational analysis of NPHS2 in 23 Chinese children with sporadic SRNS, using polymerase chain reaction (PCR), denaturing high-performance liquid chromatography (DHPLC) and DNA sequencing. This study is the first systematic investigation of NPHS2 mutations in sporadic SRNS in Chinese children.



   Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Patients and subjects
We enrolled 23 patients in this study (Table 1). They were eligible based on the following criteria: (i) they were Chinese without familial histories of renal diseases, and were children of non-consanguinous marriages; (ii) they were younger than 16 years of age at disease onset; (iii) they were diagnosed as having SRNS; (iv) their renal histology showed changes of FSGS, minimal-change nephrotic syndrome or mesangial proliferative glomerulonephritis; and (v) they had no other systemic diseases, on the basis of clinical and laboratory examinations. Nephrotic syndrome was diagnosed based on a urinary protein excretion >0.05 g/kg per 24 h with hypoalbuminaemia <25 g/l [11]. Steroid resistance was defined as the absence of remission, because proteinuria did not drop down to the level of trace on dipstick analysis after the initial 8 weeks of steroid therapy (2 mg/kg per 24 h, given in divided doses). Renal insufficiency was defined as a glomerular filtration rate <80 ml/min per 1.73 m2. We studied as controls 53 unrelated adult volunteers whose urinalyses were normal.


View this table:
[in this window]
[in a new window]
 
Table 1. Clinical data of 23 patients with sporadic steroid-resistant nephrotic syndromea

 
PCR amplification of genomic DNA
With the subjects' informed consent, samples of their blood were obtained for genetic analysis in tubes containing potassium oxalate. Genomic DNA was isolated from peripheral blood leukocytes in accordance with our previous procedures [12].

Eight sets of primers were designed to cover the sequences of introns adjacent to each exon of NPHS2. PCR primers for amplifying exon 1 and exon 8 were designed with the software Primer3 (http://www-genome.wi.mit.edu/cgi-bin/primer/primer3_www.cgi) based on the human genomic sequence (GenBank NT_004487 [GenBank] .15) and on the sequences of exon 1 (GenBank AJ279246 [GenBank] .1) and exon 8 (GenBank AJ279253 [GenBank] .1). PCR primers for amplifying exons 1 and 8 were as follows: exon 1, AGCGACTCCACAGGGACTGC and CTGACGCCCCTTAGTTACCA; exon 8, ATGCTCAGTG CTTGTCTGCT and TCACATTATGCCCCATCCTT. The primers for amplifying exons 2–7 were synthesized according to published primer sequences [10]. PCR products ranged in size between 204 and 547 bp.

Genomic DNA (50 ng) was subjected to 36–38 cycles of PCR amplification in a 25 µl volume consisting of 1 µl of 5 pmol/l of sense primer, 1 µl of 5 pmol/l of antisense primer, 1.5–3.5 mmol/l of MgCl2, 100 µmol/l of dNTPs and 1.25–1.5 U of Taq polymerase (Perkin-Elmer, Foster City, CA). Since PCR products were to be used for DHPLC analysis, mineral oil was avoided.

DNA was denatured at 94–95°C for 7 min, followed by 36–38 cycles of denaturation for 1 min at 94–95°C, annealing for 30 s at 54–68°C, extension for 45 s at 72°C, and a final extension for 7 min at 72°C in a thermocycler (GeneAmp PCR system 2400, Perkin-Elmer Applied Biosystems, Foster City, CA). Due to the high GC content of exon 1, 2% dimethylsulfoxide was added to the reaction mixture for amplification of exon 1.

DHPLC analysis
The PCR products were heated to 95°C for 3 min and cooled to 65°C at a speed of 0.5°C/min in a thermocycler to form heteroduplexes. Fifty to 100 ng of heteroduplex were then processed with a DHPLC apparatus (Transgenomic Inc., Omaha, NE) to analyse sequence variations, using the WAVE-Maker software (Version 4.1.42) [13] supplied. The column temperatures for various PCR products were as follows: 65.9°C for exon 1, 58.4°C for exon 2, 55.1°C for exon 3, 57.1°C for exon 4, 54.9°C for exon 5, 55.2°C for exon 6, 60.8°C for exon 7 and 60.8°C for exon 8. The flow rate was 0.9 ml/min.

The PCR products of NPHS2, with a single peak revealed by DHPLC, from both the patients and the controls were then mixed in a 1:1 ratio with an aliquot of PCR product with a wild genotype of NPHS2. New heteroduplexes were formed as described previously. The mixtures with the new heteroduplexes were re-analysed for sequence variations by DHPLC under the same column temperatures as mentioned previously.

Sequence analysis
DNA fragments with aberrant elution profiles revealed by DHPLC were re-amplified and sequenced directly with ABI PRISM 377 Automated Sequencer (Perkin-Elmer, Foster City, CA).

Statistical analyses
The data on genotypic and allelic frequencies in the patients and the controls were compared with {chi}2 tests.



   Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Clinical data for the patients with SRNS
We examined 14 boys and nine girls with SRNS (aged 2.5–14 years). Their clinical data are listed in Table 1. Their age at onset of disease was 8.9±4.5 years (range 1.3–13.7). Among them were seven patients with renal insufficiency. Of note is patient 5, aged 12.3 years, a girl who had oedema at the age of 11.8 years. Her urinalysis showed 4+ proteinuria with a 24 h urinary protein excretion of 9.58 g, and her glomerular filtration rate (GFR) was 24.45 ml/min per 1.73 m2. Her renal pathology showed changes of FSGS. She was diagnosed with nephrotic syndrome, and turned out to be resistant to steroid treatment. She progressed rapidly to end-stage renal disease and died 2 years ago. Her father, aged 43 years, her mother, aged 41 years, and her younger sister, aged 12.6 years, all had normal urinalyses.

DHPLC elution profiles
In order to ascertain the performance of the separation column, the standard samples were detected by DHPLC in every experiment. The variation between different experiments of the elution profiles in the standard samples was no more than 10%. By DHPLC, six aberrant elution profiles were revealed in exons 1, 2, 4 and 8 of the NPHS2 gene in some patients, and five aberrant profiles in some controls. However, a single peak was revealed in exons 3, 5, 6 and 7 of the NPHS2 gene in all of the patients and controls.

DNA sequence analysis
The nomenclature for the description of sequence variations of NPHS2 used herein was based on the reference sequence NM_014625 [GenBank] (GenBank database) and genomic sequence NT_004487 [GenBank] .16 (GenBank Database), and the recommendations of J. T. den Dunnen and S. E. Antonarakis.

The four exons of NPHS2 revealed with aberrant elution profiles by DHPLC were sequenced directly. Repeated PCRs and DNA sequencing analyses confirmed the variations in their DNA sequences (Tables 2 and 3). A heterozygous missense mutation in exon 8 of NPHS2, 1082T>C, which leads to a leucine to proline substitution (L361P) and is novel (Figure 1), was detected in one (patient 5) of 23 patients (4%), whereas it was not found in 106 chromosomes from 53 controls. A homozygous silent mutation of 954T>C in exon 8 of NPHS2 was also detected in patient 5. In order to avoid missing NPHS2 mutations in the other allele in patient 5, we re-examined NPHS2 mutations in exons 1–7 by direct sequencing, but detected none. Further mutational analysis of NPHS2 in the family of patient 5 was performed. A homozygous mutation 954T>C was found in her father, heterozygous mutations 954T>C and 1082T>C in her mother, and a homozygous mutation 954T>C and a heterozygous mutation 1082T>C in her younger sister.


View this table:
[in this window]
[in a new window]
 
Table 2. NPHS2 mutations and polymorphisms detected in 19 patients with sporadic steroid-resistant nephrotic syndromea

 

View this table:
[in this window]
[in a new window]
 
Table 3. Genotypic and allelic frequencies of seven polymorphisms of NPHS2 in 23 patients and 53 controls

 


View larger version (36K):
[in this window]
[in a new window]
 
Fig. 1. A novel mutation and three novel polymorphisms of NPHS2 were detected by sequencing in three patients. (a) The chromatogram revealed a heterozygous mutation of 1082T>C of NPHS2. (b–d) The chromatograms showed three NPHS2 polymorphisms, –51G>T, IVS3-46C>T and IVS3-21C>T, respectively. The arrows indicate mutant positions. This figure can be viewed in colour as supplementary data at NDT Online.

 
In addition, we identified one variant (–51G>T) in the 5'-untranslated region of NPHS2 in six patients and 14 controls, two variants (IVS3-46C>T and IVS3-21C>T) in intron 3 in one patient and six controls, one silent mutation (954T>C) in exon 8 in 15 patients and 37 controls, and one silent mutation (288C>T) in exon 2, one variant (IVS7-74G>C) in intron 7 and one silent mutation (1038A>G) in exon 8 in two patients and four controls, which together indicate that these variants and silent mutations are NPHS2 polymorphisms.

Of seven NPHS2 polymorphisms, four polymorphisms (288C>T, IVS7-74G>C, 954T>C and 1038A>G) have already been identified in Taiwanese Chinese [6] and in Japanese [14]. Three polymorphisms (–51G>T, IVS3-46C>T and IVS3-21C>T) are novel (Figure 1). There was no significant difference in the genotypic and allelic frequencies of the –51G>T, 288C>T, IVS3-46C>T, IVS3-21C>T, IVS7-74G>C, 954T>C and 1038A>G polymorphisms between the 23 patients and the 53 controls (Table 3).



   Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Different investigators in Europe, the Middle East and North America have recently demonstrated that 10.5–28% of children with sporadic SRNS have mutations in the NPHS2 gene [1,2,6–9]. In Orientals, however, no causative mutations in the NPHS2 gene could be detected in either 36 children with sporadic SRNS or a family with an autosomal recessive form of FSGS in Japan [15], which might be explained by postulating a different genetic background in the Japanese population. In addition, just three polymorphisms of NPHS2 have been identified in a family in Taiwan with congenital nephrotic syndrome [6]. We detected a heterozygous missense mutation (L361P) of the NPHS2 gene, which is likely to be pathogenic, in one of 23 children with sporadic SRNS (4%). This finding demonstrates that NPHS2 is also the causative gene in Chinese children with sporadic SRNS. It also suggests that the incidence of NPHS2 mutations in Chinese children with sporadic SRNS may be low, compared with the relatively high incidence of mutations in the NPHS2 gene (up to 20%) reported from Germany, Italy, Israel and the USA.

We identified a novel heterozygous mutation, 1082T>C, in exon 8 of the NPHS2 gene [which leads to a leucine to proline substitution (L361P)], in patient 5, in whom a homozygous silent mutation of 954T>C in exon 8 of NPHS2 was also detected. This sequence change was absent in 53 controls. The sequence conservation of 1082–1083 nucleotides in human NPHS2 mRNA, counted from the very beginning of the start codon, has been established by alignment analysis of human (GenBank NM_014625 [GenBank] ), mouse (GenBank NM_130456 [GenBank] ) and rat (GenBank NM_130828 [GenBank] ) NPHS2 mRNA. It has also been shown by alignment analysis of podocin in humans (Swiss-Prot Q9NP85), mice (Swiss-Prot Q91X05) and rats (Swiss-Prot Q8K4G9) that the 361st amino acid of human podocin is leucine and that the corresponding amino acid in both rats and mice is isoleucine. Moreover, Caridi et al. speculated that the substitution of leucine with proline would probably induce a secondary structural alteration of podocin [9]. In addition, the mutation of L361P affects the C-terminal domain, via which podocin associates with CD2AP, a cytoplasmic binding partner of nephrin, and with nephrin itself [16]. All of the facts mentioned above strongly suggest that the mutation 1082T>C (L361P) of NPHS2 is pathogenic.

Further mutational analysis of NPHS2 in patient 5's parents revealed that the mutation 1082T>C (L361P) was of maternal origin, and the homozygous mutation 954T>C was maternal and paternal in origin, since both her father and mother were detected to have mutations of 954T>C.

Patient 5 was clinically diagnosed to have SRNS at the age of 11.8 years; she progressed rapidly to end-stage renal disease, and her renal pathology showed changes of FSGS. All these clinical features were similar to those of patients with homozygous or compound heterozygous mutations, or a single heterozygous pathogenic mutation, in their NPHS2 genes, as reported by other groups [1,2,6,9]. From a genetic point of view, however, renal lesions due to NPHS2 mutations should be inherited following a recessive pattern that should produce an evident phenotype in either only homozygosity or only compound heterozygosity. We therefore cannot exclude the possibility of having missed a second mutation in the regulatory or non-coding regions of another allele of the NPHS2 gene in patient 5. Another possibility is that a second mutation involves another podocyte gene that interacts with podocin, via the mechanism of ‘digenic disease’ [17]. The normal urinalysis at the age of 12.6 years and the genotype of NPHS2 detected in the younger sister of patient 5, i.e. a heterozygous 1082T>C and a homozygous 954T>C, would also support these two possibilities. Therefore, the single heterozygous 1082T>C mutation could not by itself be accepted as a causative mutation. On the other hand, there may be a third possibility, in that a heterozygous missense 1082T>C mutation and a homozygous 954T>C silent mutation of NPHS2 caused the SRNS of patient 5. Some studies have shown that polymorphisms, even when not affecting amino acid substitutions, cause phenotypic variation by either affecting the structural folds of the mRNA or inactivating genes by inducing the splicing machinery to skip the mutant exons. Antignac et al. have reported that patients with only one NPHS2 mutation or variant had late onset nephrotic syndrome (147.4±50 months, n = 11). They have also observed the spontaneous development of proteinuria in some aged Nphs2 heterozygous knockout mice [1]. In addition, various other investigators observed single heterozygous mutations of NPHS2 in familial and sporadic SRNS (Table 4) [1,3,6,8,10,18], and they thought that single heterozygous mutations of NPHS2 are associated with SRNS. Taking the third possibility into account, we think that the single heterozygous NPHS2 mutation probably is the cause of patient 5's disease, which may present with a feature of the later onset nephrotic syndrome reported by Antignac et al. [1]. Thus it might be too early to exclude the possibility of the future onset of SRNS in the younger sister of patient 5, whom we still follow and continue to investigate.


View this table:
[in this window]
[in a new window]
 
Table 4. Summary of single heterozygous mutations of NPHS2 in SRNSa

 
We also detected seven variants, which are –51G>T, 288C>T, IVS3-46C>T, IVS3-21C>T, IVS7-74G>C, 954T>C and 1038A>G, of NPHS2 in some patients and controls, and believe these variants to be NPHS2 polymorphisms. Of them, three were novel polymorphisms, –51G>T, IVS3-46C>T and IVS3-21C>T. Another three NPHS2 polymorphisms, 288C>T, 954T>C and 1038A>G, have already been identified in Taiwanese Chinese [6], and one NPHS2 polymorphism, IVS7-74G>C, in Japanese [14]. These four already reported polymorphisms always occur together in either the patients or the controls, and they all existed homozygously in patient 1 (Table 2), suggesting that they might be a haplotype of NPHS2 in the Chinese population. Shin et al. [19] have demonstrated that single nucleotide polymorphisms (SNPs) of a gene may affect disease susceptibility. We therefore examined genotypic and allelic frequencies of the seven SNPs of –51G>T, 288C>T, IVS3-46C>T, IVS3-21C>T, IVS7-74G>C, 954T>C and 1038A>G of NPHS2 in both the patients and the controls, but no significant difference was found. These findings suggest that there is no association between the seven SNPs of NPHS2 and SRNS in Chinese children.

In our previous study [20], we detected a compound heterozygous mutation of both 467_468insT and 503G>A in the NPHS2 gene in a Chinese family with autosomal recessive SRNS, which demonstrates that NPHS2 mutations do occur in Chinese patients with familial SRNS with an autosomal recessive inheritance.

We applied the DHPLC technique for screening mutations in the NPHS2 gene, because sequence variations can be easily recognized by different elution profiles on DHPLC, and because both the sensitivity and the specificity of DHPLC in detecting mutations exceed 96% [20]. In order to ensure the sensitivity and specificity of DHPLC, we mixed an aliquot of the PCR product of a wild genotype of NPHS2 with the target PCR product in a 1:1 ratio, to avoid missing homozygous mutations, and analysed the standard samples in every experiment to ascertain that the variations of elution profiles in the standard samples among different experiments was no more than 10%. Our results also confirmed the high sensitivity and specificity of DHPLC in detecting mutations. By using DHPLC, we identified four already reported polymorphisms of NPHS2 and three novel polymorphisms, which confirmed the high sensitivity of the technique of DHPLC. No NPHS2 mutation was detected by direct sequencing in NPHS2 exons 1–7 of patient 5 whose elution profiles revealed by DHPLC were normal, which confirmed the high specificity of the technique of DHPLC.

In summary, a novel missense mutation (L361P) of NPHS2 was detected in one of 23 Chinese children with sporadic SRNS, demonstrating that NPHS2 mutations also occur in Chinese patients with sporadic SRNS. Although the studied cohort was small, our investigation supports the necessity of genetic examination for mutations in the NPHS2 gene in Chinese children with sporadic SRNS. Further functional analyses are required to determine the pathogenic role of L361P.



   Acknowledgments
 
We thank the patients and their families for their participation; Dr Ling Liu, Dr Junjie He, Dr Ying Shen, Dr Qun Meng, Dr Ruixia Lin, Dr Jieqiu Zhuang and Professor Jiong Qin for referring patients; and Professor Dingfang Bu and Mrs Lixia Yu for technical help. This study was supported by grants from National Nature Science Foundation of China (30170992, 39770780 and 39970775), Nature Science Foundation of Beijing (7032029) and Human Disease Genomic Center of Peking University (2000-A-13).

Conflict of interest statement. None declared.



   References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 

  1. Weber S, Gribouval O, Esquivel EL et al. NPHS2 mutation analysis shows genetic heterogeneity of steroid-resistant nephrotic syndrome and low post-transplant recurrence. Kidney Int 2004; 66: 571–579[CrossRef][Web of Science][Medline]
  2. Ruf RG, Lichtenberger A, Karle SM et al. Patients with mutations in NPHS2 (podocin) do not respond to standard steroid treatment of nephrotic syndrome. J Am Soc Nephrol 2004; 15: 722–732[Abstract/Free Full Text]
  3. Boute N, Gribouval O, Roselli S et al. NPHS2, encoding the glomerular protein podocin, is mutated in autosomal recessive steroid-resistant nephrotic syndrome. Nat Genet 2000; 24: 349–354[CrossRef][Web of Science][Medline]
  4. Kestila M, Lenkkeri U, Mannikko M et al. Positionally cloned gene for a novel glomerular protein—nephrin—is mutated in congenital nephrotic syndrome. Mol Cell 1998; 1: 575–582[CrossRef][Web of Science][Medline]
  5. Kaplan JM, Kim SH, North KN et al. Mutations in ACTN4, encoding alpha-actinin-4, cause familial focal segmental glomerulosclerosis. Nat Genet 2000; 24: 251–256[CrossRef][Web of Science][Medline]
  6. Karle SM, Uetz B, Ronner V, Glaeser L, Hildebrandt F, Fuchshuber A. Novel mutations in NPHS2 detected in both familial and sporadic steroid-resistant nephrotic syndrome. J Am Soc Nephrol 2002; 13: 388–393[Abstract/Free Full Text]
  7. Frishberg Y, Rinat C, Megged O, Shapira E, Feinstein S, Raas-Rothschild A. Mutations in NPHS2 encoding podocin are a prevalent cause of steroid-resistant nephrotic syndrome among Israeli-Arab children. J Am Soc Nephrol 2002; 13: 400–405[Abstract/Free Full Text]
  8. Caridi G, Bertelli R, Di Duca M et al. Broadening the spectrum of diseases related to podocin mutations. J Am Soc Nephrol 2003; 14: 1278–1286[Abstract/Free Full Text]
  9. Caridi G, Bertelli R, Carrea A et al. Prevalence, genetics, and clinical features of patients carrying podocin mutations in steroid-resistant nonfamilial focal segmental glomerulosclerosis. J Am Soc Nephrol 2001; 12: 2742–2746[Abstract/Free Full Text]
  10. Tsukaguchi H, Sudhakar A, Le TC et al. NPHS2 mutations in late-onset focal segmental glomerulosclerosis: R229Q is a common disease-associated allele. J Clin Invest 2002; 110: 1659–1666[CrossRef][Web of Science][Medline]
  11. Guan N, Ding J, Zhang J, Yang J. Expression of nephrin, podocin, alpha-actinin, and WT1 in children with nephrotic syndrome. Pediatr Nephrol 2003; 18: 1122–1127[CrossRef][Web of Science][Medline]
  12. Wang F, Ding J, Guo S, Yang J. Phenotypic and genotypic features of Alport syndrome in Chinese children. Pediatr Nephrol 2002; 17: 1013–1020[CrossRef][Web of Science][Medline]
  13. Ye J, Ding J, Chen Y, Huang J, Yang J. Analysis of glucocorticoid receptor gene polymorphisms by denaturing high-performance liquid chromatography. Beijing Da Xue Xue Bao 2003; 35: 394–398[Medline]
  14. Haga H, Yamada R, Ohnishi Y, Nakamura Y, Tanaka T. Gene-based SNP discovery as part of the Japanese Millennium Genome Project: identification of 190,562 genetic variations in the human genome. Single-nucleotide polymorphism. J Hum Genet 2002; 47: 605–610[CrossRef][Web of Science][Medline]
  15. Maruyama K, Iijima K, Ikeda M et al. NPHS2 mutations in sporadic steroid-resistant nephrotic syndrome in Japanese children. Pediatr Nephrol 2003; 18: 412–416[Web of Science][Medline]
  16. Schwarz K, Simons M, Reiser J et al. Podocin, a raft-associated component of the glomerular slit diaphragm, interacts with CD2AP and nephrin. J Clin Invest 2001; 108: 1621–1629[CrossRef][Web of Science][Medline]
  17. Koziell A, Grech V, Hussain S et al. Genotype/phenotype correlations of NPHS1 and NPHS2 mutations in nephrotic syndrome advocate a functional inter-relationship in glomerular filtration. Hum Mol Genet 2002; 11: 379–388[Abstract/Free Full Text]
  18. Lowik MM, Levtchenko EN, Monnens LA, van den Heuvel LP. WT-1 and NPHS2 mutation analysis in patients with non-familial steroid-resistant focal-segmental glomerulosclerosis. Clin Nephrol 2003; 59: 143–146[Web of Science][Medline]
  19. Shin HD, Park BL, Kim LH et al. Association of tumor necrosis factor polymorphisms with asthma and serum total IgE. Hum Mol Genet 2004; 13: 397–403[Abstract/Free Full Text]
  20. Yu Z, Ding J, Guan N et al. A novel mutation of NPHS2 identified in a Chinese family. Pediatr Nephrol 2004; 19: 1285–1289[CrossRef][Web of Science][Medline]
Received for publication: 13. 8.04
Accepted in revised form: 5. 1.05


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J. Am. Soc. Nephrol.Home page
L. M. McKenzie, S. L. Hendrickson, W. A. Briggs, R. A. Dart, S. M. Korbet, M. H. Mokrzycki, P. L. Kimmel, T. S. Ahuja, J. S. Berns, E. E. Simon, et al.
NPHS2 Variation in Sporadic Focal Segmental Glomerulosclerosis
J. Am. Soc. Nephrol., November 1, 2007; 18(11): 2987 - 2995.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Supplementary data
Right arrow All Versions of this Article:
20/5/902    most recent
gfh769v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (11)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Yu, Z.
Right arrow Articles by Yang, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yu, Z.
Right arrow Articles by Yang, J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?