Skip Navigation


NDT Advance Access originally published online on December 7, 2004
Nephrology Dialysis Transplantation 2005 20(2):312-318; doi:10.1093/ndt/gfh606
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
20/2/312    most recent
gfh606v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (1)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Wolf, S. C.
Right arrow Articles by Brehm, B. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wolf, S. C.
Right arrow Articles by Brehm, B. R.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Nephrol Dial Transplant Vol. 20 No. 2 © ERA–EDTA 2004; all rights reserved


Original Article

Influence of growth factors on the proliferation of vascular smooth muscle cells isolated from subtotally nephrectomized rats after endothelin or angiotensin II antagonism

Sabine C. Wolf1,*, Gabriele Sauter1,*, Hans-Peter Rodemann3, Teut Risler1 and Bernhard R. Brehm1,2

1 Medical Clinic III, Department of Cardiology, Nephrology, Hypertension and Renal Failure, 2 Department of General Neurology, Hertie Institute for Clinical Brain Research and 3 Section of Radiobiology and Molecular Environmental Research, Department of Radiotherapy, Eberhard-Karls-University, D-72076 Tübingen, Germany

Correspondence and offprint requests to: Bernhard R. Brehm, MD, Hoppe-Seylerstr. 3, D-72076 Tübingen, Germany. Email: bernhard.brehm{at}onlinehome.de



   Abstract
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Background. Cardiovascular disease is the most important cause of death in patients with end-stage renal disease. In uraemia, the renin–angiotensin–aldosterone and endothelin (ET) systems are activated. It is not known whether inhibition of these systems attenuates the proliferation of isolated smooth muscle cells of uraemic rats.

Methods. Subtotally nephrectomized (SNX) rats were treated with an ETA receptor antagonist, an ETAB receptor antagonist, the angiotensin type 1 (AT1) receptor antagonist losartan (all 10 mg/kg body weight/day) or the angiotensin-converting enzyme (ACE) inhibitor trandolapril (0.1 mg/kg body weight/day) or received no medication (SNX) for 12 weeks. Then, aortal smooth muscle cells (SMCs) were isolated and cultivated. After incubation of SMCs with different growth factors (5–7 days), proliferation was measured using a bromodeoxyuridine enzyme-linked immunosorbent assay (BrdU ELISA).

Results. Higher maximum levels of proliferation were found in SMCs from untreated SNX rats than in SMCs from control animals [platelet-derived growth factor-BB (PDGF-BB) 486.60±8.27 vs 346.74±4.60%, basic fibroblast growth factor (bFGF) 176.68±6.50 vs 123.71±1.49%, tumour necrosis factor-{alpha} (TNF-{alpha}) 153.38±10.16 vs 122.27±1.41%]. Treatment with ET receptor antagonists or losartan attenuated growth factor-stimulated proliferation (PDGF-BB: ETA receptor antagonist, 135.71±1.08%; ETAB receptor antagonist, 122.72±0.58%; losartan: 103.69±1.83%, n = 8). SMCs from trandolapril-treated rats showed an increased response (PDGF-BB 663.48±7.00%, n = 8).

Conclusions. Treatment of SNX rats with ET receptor antagonists or losartan reduced growth factor-induced SMC proliferation in vitro. However, further investigations with uraemic patients have to clarify whether angiotensin or ET receptor antagonists inhibit the development of atherosclerosis.

Keywords: growth factors; proliferation; SMC; uraemia



   Introduction
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Patients with end-stage renal disease (ESRD) have a significantly higher risk of suffering from cardiovascular disease (CVD) than the general population. Even though several traditional risk factors for atherosclerosis are associated with ESRD, they cannot fully explain the fact that CVD mortality is 10–20 times higher in uraemic patients [1]. Certain specific additional risk factors such as increased oxidative stress, uraemic toxins and a chronic inflammatory state with an increase in pro-inflammatory cytokine and growth factor levels are thought to contribute to the development and progression of atherosclerosis in uraemia. Furthermore, the activation of the renin–angiotensin–aldosterone system (RAAS) and the endothelin (ET)-1 system [2] seems to play a role. Therefore, inhibiting these systems with angiotensin-converting enzyme (ACE) inhibitors, angiotensin type 1 (AT1) receptor antagonists or ET receptor antagonists may represent promising strategies to prevent the accelerated development of atherosclerosis in uraemia.

During the past several years, experimental data have illuminated the role of inflammation in atherogenesis [3] with the recruitment of macrophages and T lymphocytes to the developing lesion, where they secrete numerous growth factors. Thereby, they are able to stimulate proliferation and migration of smooth muscle cells (SMCs).

In uraemia, pro-inflammatory cytokine and growth factor levels [e.g. tumour necrosis factor (TNF-{alpha}), interleukin (IL)-1, IL-6, C-reactive protein (CRP), monocyte chemoattractant protein-1 (MCP-1)] are increased [4]. It is not known, however, whether SMCs in uraemia respond differently to growth factors. Moreover, the effect of ET-1 or angiotensin II antagonism on SMC proliferation rate has not been clarified to date.

In the present study, we investigated whether the proliferative response to several growth factors differs between aortal SMCs isolated from control and uraemic rats and how treatment of uraemic rats with different antihypertensive drugs influences the response to these growth factors.



   Methods
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Animals
Male Sprague–Dawley rats weighing ~200 g were purchased from Charles River, Kisslegg, Germany, and housed individually. All except for the control animals underwent a two-step five-sixths subtotal nephrectomy (SNX). First, the right kidney was removed under anaesthesia with ketamin (60–80 mg/kg body weight) and xylazin (5–15 mg/kg body weight). One week later, the lower and upper poles of the remaining kidney were dissected. After surgery, one group of animals received no treatment (SNX), the others were treated with the selective ETA receptor antagonist LU 302146 (Knoll, Ludwigshafen, Germany; 10 mg/kg body weight/day), the unselective ETAB receptor antagonist LU 302872 (Knoll 10 mg/kg body weight/day), trandolapril (Knoll; 0.1 mg/kg body weight/day) or losartan (MSD Sharp and Dohme, Haar, Germany; 10 mg/kg body weight/day), respectively. All medications were administered orally in the drinking water. The animals received a diet low in salt but high in protein to prevent the development of hypertension. After 12 weeks of treatment, the rats were killed and the hearts and thoracic aortas were explanted. All animal procedures were conducted according to the guidelines of the ethics committee of the University of Tübingen.

Cell culture
Primary cultures of SMCs were obtained by isolating the cells growing out from small pieces of the explanted aortas cultivated in Dulbecco's modified Eagle's medium (DMEM), supplemented with 20% fetal calf serum (FCS; BioWhittaker) and 5% penicillin (100 U/ml)/streptomycin (100 µg/ml, Gibco) using cloning rings. A few days later, cell clones were isolated. Smooth muscle origin was confirmed immunocytochemically using a monoclonal antibody against smooth muscle {alpha}-actin (Sigma-Aldrich).

Cell proliferation assay
From each animal, 2–7 subcultured SMC clones (passages 3–10) were grown to confluence, detached with trypsin, combined and seeded into 96-well microplates (10 000 cells/well) using 200 µl of DMEM + 5% FCS + 5% penicillin/streptomycin. After 24 h, the culture medium was replaced by medium containing different dilutions of platelet-derived growth factor-BB (PDGF-BB; 10–13–10–9 mol/l), basic fibroblast growth factor (bFGF; 10–14–10–10 mol/l), TNF-{alpha} (10–12–10–9 mol/l), angiotensin II (10–12–10–7 mol/l) (all from Sigma-Aldrich), aldosterone (10–12–10–7 mol/l; Fluka) or ET-1 (10–13–10–7 mol/l; Calbiochem). After 5 (for PDGF-BB) or 7 (for all other substances) days, proliferation was determined by measuring the incorporation of 5-bromo-2'-deoxyuridine (BrdU) in an 18 h period with a colorimetric cell proliferation enzyme-linked immunosorbent assay (ELISA; Roche) as described previously [5].

Real-time RT–PCR
For the determination of angiotensin and ET receptor mRNA expression, total RNA was isolated from three confluent SMC cultures and from left ventricles of control and SNX animals using RNazol (Tel-Test). Purity and yield were assessed spectrophotometrically. Subsequently, aliquots of total RNA (1 µg) were reverse-transcribed with TaqMan® Reverse Transcription Reagents (Applied Biosystems) in a volume of 50 µl according to the manufacturer's instructions. Subsequently, 2 µl cDNA samples were amplified in a volume of 20 µl containing 1x SYBR-Green-PCR-Master Mix (Applied Biosystems) and the respective forward and reverse primers (300 nmol/l). The primers designed using Primer Express® Primer Design Software v2.0 and purchased from Invitrogen were: GAPDH forward, AACTCCCTCAAGATTGTCAGCAA; GAPDH reverse, GGCTAAGCAGTTGGTGGTGC; ETA receptor forward, ATTGCCCTCAGCGAACAC; ETA receptor reverse, CAACCAAGCAGAAAGACGGTC; ETB receptor forward, TGGAGCTGAGATGTGCAAGC; ETB receptor reverse, TGATCCCCACAGAAGCCTTC; AT1a receptor forward, GCCAGTTTGCCAGCTGTCAT; AT1a receptor reverse, CGCGCACACTGTGATATTGG; AT2 receptor forward, ATCCCTGGCAAGCATCTTATGT; AT2 receptor reverse, ATGTTGGCAATGAGGACAGACA. Polymerase chain reaction (PCR) amplification was performed in triplicate (2 min at 50°C, 10 min at 95°C, 15 s at 95°C and 1 min at 60°C for a total of 40 cycles) in an ABI PrismTM 7700 sequence detector (Applied Biosystems). The expression of treated (sample) cells relative to untreated (control) cells was determined using the ‘delta-delta method’ presented by PE Applied Biosystems: ratio = 2–({Delta}CTsample {Delta}CTcontrol) = 2{Delta}{Delta}CT.

Statistical analysis
The effects of different growth factor concentrations on SMC proliferation were analysed using one-way ANOVA, followed by Dunnett's test. Bonferroni's multiple comparison test was used to determine the differences in proliferation between SMCs from different animals under the influence of one growth factor concentration. Statistical analyses of ET and AT receptor mRNA expression in control and SNX animals were conducted with unpaired t-test or Dunnett's test, respectively. P-values ≤0.05 were considered statistically significant. All data are presented as a percentage of the respective controls. The mean±SEM of at least three replicates was used for statistical comparison.



   Results
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Decrease of myocardial angiotensin and endothelin receptor mRNA expression in uraemic rats
Real-time RT–PCR revealed a significant downregulation of ETA and ETB receptor mRNA expression in the left ventricle of SNX rats (ETA receptor, 41.11± 1.59%, n = 3, P ≤ 0.01 vs control, 100±11.01%, n = 3; ETB receptor, 23.7±12.85%, n = 3, P ≤ 0.05 vs control, 100±13.83%, n = 3; data not shown). The analysis of AT1a and AT2 receptor mRNA expression revealed a dramatic reduction to undetectable levels in SNX rats.

Decrease of angiotensin and endothelin receptor mRNA expression in cultured SMCs from SNX rats
In cultured SMCs from SNX rats, downregulation of AT1a, AT2, ETA and ETB receptor mRNA was determined by real-time RT–PCR (AT1a receptor: SNX 74.5±5.45%, n = 9, P ≤ 0.05 vs control, 100± 3.24%, n = 12; trandolapril 42.4±3.77%, n = 6, P ≤ 0.05; losartan 110.7±12.84, n = 6, P ≤ 0.01; ETA antagonist 145±21.24%, n = 3, P ≤ 0.01; ETAB antagonist 39.2±2.47%, n = 3, P ≤ 0.05; AT2 receptor: SNX 28.1±3.14%, n = 6, P>0.05, vs control, 100± 10.21%, n = 9; trandolapril 183.4±44.55%, n = 6, P>0.05; losartan 424.0±105.0%, n = 4, P ≤ 0.01; ETA antagonist 166.2±50.6% n = 6, P>0.05; ETAB antagonist 806.6±139.6%, n = 3, P ≤ 0.01; ETA receptor: SNX 61.6±7.04%, n = 3, P ≤ 0.05 vs control, 100±7.91%, n = 9; ETB receptor: SNX 57.8±3.37%, n = 6, P ≤ 0.01 vs control, 100±3.24%, n = 9; data not shown).

Differences between control and SNX animals in terms of SMC proliferation
To study the effects of uraemia in vivo on the proliferation of isolated SMCs, the response of cultured SMCs from uraemic and control animals to PDGF-BB, bFGF, TNF-{alpha}, angiotensin II, aldosterone and ET-1 was determined.

Low concentrations of PDGF-BB (10–13– 10–12 mol/l), bFGF (10–13–10–12 mol/l) and TNF-{alpha} (10–12–10–10 mol/l) increased growth in SMCs derived from the control animals (P ≤ 0.05 compared with cells treated with cytokine-free medium). SMCs derived from SNX animals showed no increase in proliferation when incubated with these concentrations. After incubation with high concentrations of the same growth factors, SMCs from SNX rats showed a higher increase in proliferation than control SMCs. TNF-{alpha} (10–9 mol/l) increased proliferation to 153.38± 10.16 vs 122.27±1.41% in control (n = 8, P ≤ 0.01, Figure 1a), 10–9 mol/l PDGF-BB resulted in 486.60± 8.27 vs 346.74±4.60% in control (n = 8, P ≤ 0.01, Figure 1b) and 10–10 mol/l bFGF stimulated proliferation to 176.68±6.50% (n = 6) vs 123.71±1.49% (n = 4) in control (P ≤ 0.01, Figure 1c).



View larger version (26K):
[in this window]
[in a new window]
 
Fig. 1. (a) Effects of PDGF-BB on proliferation of SMCs isolated from control and subtotally nephrectomized (SNX) rats. SMCs were incubated with different concentrations of PDGF-BB for 5 days. Then proliferation was measured using a BrdU ELISA. Mean±SEM for each concentration are given (n = 4–8). While low concentrations of PDGF-BB stimulated proliferation in control cells only, the maximum proliferation reached in cells from SNX rats exceeded the maximum in control. (b) Effects of bFGF on proliferation of SMCs isolated from control and SNX rats as determined by BrdU ELISA. SMCs were incubated with different concentrations of bFGF for 7 days. Mean±SEM for each concentration are given (n = 4–8). Low concentrations of bFGF had a greater effect on SMCs from control rats. The maximum reached with high concentrations was higher in SNX rats. (c) Effects of TNF-{alpha} on proliferation of SMCs isolated from control and SNX rats as determined by BrdU ELISA. SMCs were incubated with different concentrations of TNF-{alpha} for 7 days. Mean±SEM for each concentration are shown (n = 4–8). (d) Effects of different concentrations of angiotensin II on proliferation of SMCs isolated from control and SNX rats as determined by BrdU ELISA after 7 days. Mean±SEM for each concentration are shown (n = 4–8). Angiotensin II stimulated proliferation of SMCs from control animals but had no effect on SMCs from SNX rats. (e) Effects of different concentrations of aldosterone on proliferation of SMCs isolated from control and SNX rats as determined by BrdU ELISA after 7 days. Mean±SEM for each concentration are shown (n = 4–8). Aldosterone stimulated proliferation of SMCs from control but not from SNX animals. (f) Effects of different concentrations of endothelin-1 on proliferation of SMCs isolated from control and SNX rats as determined by BrdU ELISA after 7 days. Mean±SEM for each concentration are shown (n = 4–8). Endothelin-1 inhibited SMC proliferation in SNX rats but had no significant effect on SMCs from controls.

 
Angiotensin II and aldosterone stimulated proliferation in control SMCs (10–7 mol/l angiotensin II, 141.29±3.37%, n = 8; 10–11 mol/l aldosterone, 147.01±4.77%, n = 4; P ≤ 0.05 compared with medium control, Figure 1d), whereas they had no proliferative effect on SNX cells (angiotensin II, 98.02±3.02%; aldosterone, 85.62±2.54%; Figure 1e). ET-1 had no effect on the proliferation of control SMCs (maximum 102.36±2.99%, n = 4 vs 100±2.21%, n = 8 in unstimulated cells, P>0.05) but inhibited growth in SNX SMCs (minimum 81.08±0.26%, n = 4 vs 100±4.46%, n = 8 in unstimulated cells P ≤ 0.01; Figure 1f).

Influence of treatment with ET receptor antagonists, losartan or trandolapril on SMC proliferation in comparison with untreated SNX rats
In SMCs from untreated SNX rats, PDGF-BB (10–9 mol/l) induced the maximum proliferation of 486.6±8.27% (as compared with unstimulated cells, n = 8, P ≤ 0.01). The increase in proliferation induced by PDGF-BB (10–9 mol/l) was significantly reduced in SMCs from SNX rats treated with the ETA receptor antagonist (135.71±1.08%, n = 8, P ≤ 0.01), the ETAB receptor antagonist (122.72±0.58%, n = 8, P ≤ 0.01) or the AT1 receptor antagonist losartan (103.69±1.83%, n = 8, P ≤ 0.01, Figure 2a).



View larger version (24K):
[in this window]
[in a new window]
 
Fig. 2. (a) Effects of treatment of SNX rats with ETA or ETAB receptor antagonists on PDGF-BB-induced SMC proliferation. Proliferation measured using a BrdU ELISA was attenuated after treatment. Mean±SEM for each concentration are given (n = 4–8). (b) Effects of treatment of SNX rats with ETA or ETAB receptor antagonists on bFGF-induced SMC proliferation. Mean±SEM for each concentration are given (n = 4–8). The maximum proliferation in SMCs from treated animals was lower than in untreated SNX rats. (c) Effects of treatment of SNX rats with ETA or ETAB receptor antagonists on TNF-{alpha}-induced SMC proliferation. Mean±SEM for each concentration are given (n = 4–8). After treatment with the ETA receptor antagonist and losartan, lower maximum levels of proliferation were reached. SMCs isolated after treatment with the ETAB receptor antagonist showed a stronger response to TNF-{alpha} than those from untreated SNX rats. (d) Effects of treatment of SNX rats with trandolapril on PDGF-BB-induced SMC proliferation. Mean±SEM for each concentration are given (n = 4–8). SMCs isolated after treatment with the ACE inhibitor exhibited a stronger response to PDGF-BB than those of untreated SNX rats. (e) Effects of treatment of SNX rats with trandolapril on bFGF-induced SMC proliferation. Mean±SEM for each concentration are given (n = 4–8). SMCs isolated after treatment with the ACE inhibitor exhibited a stronger response to bFGF than those of untreated SNX rats. (f) Effects of treatment of SNX rats with trandolapril on TNF-{alpha}-induced SMC proliferation. Mean±SEM for each concentration are given (n = 4–8). Proliferation induced by TNF-{alpha} was stronger after treatment with trandolapril.

 
Stimulation with bFGF (10–10 mol/l) was followed by an increase in proliferation to a maximum of 176.68±6.50% (n = 6, P ≤ 0.01) in SMCs from untreated SNX animals. After treatment with the ETA antagonist, bFGF-induced SMC growth was reduced to 108.64±1.09% (n = 4, P ≤ 0.01). Blockade of ETA and ETB receptors reduced the maximum response to 108.2±1.21% (n = 4, P ≤ 0.01). After chronic treatment with losartan, the growth rate was only 121.80±1.19% (n = 4, P ≤ 0.01; Figure 2b).

TNF-{alpha} (10–9 mol/l) stimulated proliferation in SMCs from SNX animals to a maximum of 153.4± 10.16% (n = 8, P ≤ 0.01 compared with untreated cells). ETA receptor antagonism reduced the maximum response to 115.63±0.41% (n = 8, P ≤ 0.01), whereas ETAB receptor antagonism resulted in a higher SMC responsiveness to TNF-{alpha} (maximum 202±1.82%, n = 8, P ≤ 0.01). In contrast, after losartan treatment, TNF-{alpha} reduced SMC proliferation (minimum 77.82± 1.91%, n = 8, P ≤ 0.01, Figure 2c).

SMCs isolated after trandolapril treatment showed a greater increase in proliferation in response to PDGF-BB (10–9 mol/l), bFGF (10–10 mol/l) and TNF-{alpha} (10–9 mol/l) than cells originating from all other animals. The maximum response to PDGF-BB (10–9 mol/l) was 663.48±7.00% (n = 8, P ≤ 0.01 compared with SNX) (Figure 2d). bFGF-induced BrdU incorporation reached its peak at 568.81±17.94% (n = 4, P ≤ 0.01, Figure 2e). TNF-{alpha} stimulated SMC proliferation up to 356.34±10.43% (n = 8, P ≤ 0.01, Figure 2f).



   Discussion
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
In the present in vitro study, we have observed that SMCs isolated from SNX rats show a higher maximum proliferation rate in response to the growth factors PDGF-BB, bFGF and TNF-{alpha}. After treatment with ETA and ETAB receptor antagonists or the AT1 receptor antagonist losartan, this effect was attenuated. In contrast, the maximum growth factor-induced proliferation in SMCs from SNX rats treated with the ACE inhibitor trandolapril was higher than in SMCs from SNX and control rats. In SMCs from control rats, angiotensin II and aldosterone stimulated proliferation, but did not do so in SMCs from SNX rats. ET-1 inhibited SMC proliferation in SNX rats but had no effect on control cells. The phenomenon that plasma cytokine levels are increased in uraemia could explain the lack of effect of low PDGF-BB, bFGF and TNF-{alpha} concentrations on the proliferation of SMCs isolated from untreated SNX rats in our study. High circulating or local levels of these growth factors in vivo might have resulted in a downregulation of the corresponding growth factor receptors. However, when high concentrations were used, the effect of PDGF-BB, bFGF and TNF-{alpha} on proliferation was more pronounced in SMCs derived from the uraemic animals than in controls. This indicates that the uraemic state in vivo could have induced genetic changes in the SMCs still present after isolation and cultivation. This concept is supported further by the different effects that angiotensin II, aldosterone and ET-1 had on proliferation in SMCs from control and SNX rats. Angiotensin II and aldosterone induced a significant increase in control SMCs, but did not stimulate SMCs from SNX rats. ET-1 inhibited proliferation in SMCs from SNX animals, but had no effect on control cells. In a study on septic rats by Bucher et al. [6], it could be demonstrated that increased angiotensin II plasma levels led to the downregulation of AT1 receptors. Via AT1 receptors, angiotensin II stimulates DNA and protein synthesis in SMCs [7], and enhances the effects of other growth factors [8]. The decrease in angiotensin receptor mRNA expression we found in the myocardium and SMCs of SNX rats can be seen as a downregulation due to an activated RAAS in uraemia in general. A therapy with trandolapril or an ETAB receptor antagonist reduced the AT1a receptor gene transcripts, whereas the therapy with losartan or ETA increased the mRNA. In contrast, a strong increase of AT2 receptor mRNA was present after losartan and ETAB antagonism; both inhibited growth factor-promoted SMC proliferation whereas a mild increase in AT2 receptor gene transcription was not able to reduce the accelerated SMC growth rate.

In the present study, we found SMCs from SNX rats treated with the ETA receptor antagonist to show almost control levels of proliferation in response to PDGF-BB, bFGF and TNF-{alpha}. This implies that via the ETA receptor, ET-1 might play a role in a certain sensitization of SMCs in vivo, making them more responsive to pro-atherogenic growth factors. SMCs from rats treated with the combined ETAB receptor antagonist also showed control-like reactions to PDGF-BB and bFGF. When stimulated with TNF-{alpha}, however, their proliferation was stronger than in SNX. This underlines the antiproliferative significance of the ETB receptor found by Murakoshi et al. [9] and shows the importance of a physiological balance between ETA and ETB receptors.

SMCs from rats treated with the ACE inhibitor trandolapril exhibited a stronger growth factor-stimulated proliferation than SMCs from any other animal. Treatment with trandolapril thus seemed to have sensitized the cells to PDGF-BB, bFGF and TNF-{alpha}. This might arise from an increase in bradykinin synthesis under trandolapril leading to a sensitization of mitogen-activated protein kinases [10], which is essential for growth factor-mediated stimulation of DNA synthesis [11]. Accordingly, the augmented SMC proliferation in response to PDGF-BB, bFGF and TNF-{alpha} seen after trandolapril treatment might be due to a modified state of activation in these cells.

In contrast to our findings, several in vitro studies, and also in vivo models using balloon angioplasty, demonstrated a growth-inhibiting function of both ACE inhibitors and AT1 receptor antagonists [12]. However, several observations indicated that ACE inhibitors do not always reduce proliferation rates in smooth muscle cells. In a direct in vivo comparison of an AT1 receptor antagonist and the ACE inhibitor temocapril, Teng et al. [13] found that temocapril was not able to inhibit SMC proliferation in spontaneously hypertensive rats (SHRs) whereas it did in Wistar rats. Richter et al. showed in an in vivo model of transplant vasculopathy that the ACE inhibitor enalapril was able to reduce SMC proliferation in small intramyocardial arteries, but not in large epicardial vessels if given before intervention [14]. For an AT1 receptor antagonist, the same group could not demonstrate an antiproliferative function in large epicardial vessels. In our experiments, trandolapril even increased SMC proliferation under different growth factors. Furthermore, Wilson et al. [15] could demonstrate a comparable effect with an increased vessel stenosis using captopril in a model of neointima proliferation in a porcine coronary artery culture model. In these experiments, losartan inhibited neointima formation whereas captopril increased vessel stenosis by 200%. In an experiment with SHRs, Bravo et al. [16] found the proliferation of isolated carotid SMCs to be reduced after 16 weeks of losartan treatment but not after captopril medication. Additionally, cilazapril was demonstrated to inhibit neointimal formation in ballooned guinea pig carotid but not rabbit iliac arteries [17]. In porcine models of restenosis involving injury to the coronary arteries, neither cilazapril [18], enalapril [19], trandolapril nor captopril [20] were effective. Even worse were the results in patients with the ACE gene polymorphism DD, because when these patients were treated with an ACE inhibitor, an increased frequency of in-stent restenosis was found. This indicates that the growth-inhibitory action of ACE inhibitors depends on the genetic background of the individuals and also on the treatment regime [21]. In comparison with these in vivo analyses, our studies were done in vitro after isolation of aortal SMCs.

Limitations of the study
The evolution of atherosclerosis is a very complex mechanism involving SMCs, but also many other components. Rupture of atherosclerotic plaques has been identified as the proximate event in the majority of cases of acute ischaemic syndromes. Vulnerable plaques are characterized by a high lipid content, increased numbers of inflammatory cells and extensive adventitial and intimal neovascularity. The fibrous cap of an atherosclerotic plaque may become thin and rupture as a result of the depletion of matrix components through the activation of enzymes secreted by SMCs. This indicates that SMC proliferation represents only one component of atherosclerosis. Whether the inhibition of SMC proliferation in uraemia reduces the induction and progression of atherosclerosis cannot be fully answered by our investigations. However, in advanced coronary atherosclerotic plaques associated with unstable angina, an augmentation of inflammatory cell activity with significantly increased SMC areas has been shown. Therefore, the inhibition of SMC proliferation might represent one means of reducing susceptibility to plaque rupture.

In summary, we demonstrated that uraemia in the rat entails modifications in SMC responsiveness to various pro-atherogenic growth factors. These changes are still present when SMCs are isolated and subcultured. Consequently, certain factors present in the uraemic vasculature seem to induce permanent genetic changes in SMCs. Furthermore, we revealed that treatment of SNX rats with ET receptor antagonists or the AT1 receptor antagonist losartan more or less reduces accelerated proliferation of SMCs. Further investigations concerning the intracellular signalling mechanisms involved in the uraemia-related SMC modifications observed in this study should help to come to a deeper understanding of atherogenesis in uraemia.



   Acknowledgments
 
This work was supported in part by a grant from the Federal Ministry of Education and Research (Fö. 01KS9602) and the Interdisciplinary Center of Clinical Research Tübingen (IZKF).

Conflict of interest statement. None declared.



   Notes
 
*These authors contributed equally to this work. Back



   References
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 

  1. Foley RN, Parfrey PS, Sarnak MJ. Epidemiology of cardiovascular disease in chronic renal disease. J Am Soc Nephrol 1998; 9: S16–S23[CrossRef][Medline]
  2. Lariviere R, Lebel M. Endothelin-1 in chronic renal failure and hypertension. Can J Physiol Pharmacol 2003; 81: 607–621[CrossRef][Web of Science][Medline]
  3. Libby P, Ridker PM, Maseri A. Inflammation and atherosclerosis. Circulation 2002; 105: 1135–1143[Abstract/Free Full Text]
  4. Papayianni A, Alexopoulos E, Giamalis P et al. Circulating levels of ICAM-1, VCAM-1, and MCP-1 are increased in haemodialysis patients: association with inflammation, dyslipidaemia, and vascular events. Nephrol Dial Transplant 2002; 17: 435–441[Abstract/Free Full Text]
  5. Brehm BR, Wolf SC, Bertsch D et al. Effects of nebivolol on proliferation and apoptosis of human coronary artery smooth muscle and endothelial cells. Cardiovasc Res 2001; 49: 430–439[Abstract/Free Full Text]
  6. Bucher M, Ittner KP, Hobbhahn J, Taeger K, Kurtz A. Downregulation of angiotensin II type 1 receptors during sepsis. Hypertension 2001; 38: 177–182[Abstract/Free Full Text]
  7. Weber H, Webb ML, Serafino R et al. Endothelin-1 and angiotensin-II stimulate delayed mitogenesis in cultured rat aortic smooth muscle cells: evidence for common signaling mechanisms. Mol Endocrinol 1994; 8: 148–158[Abstract/Free Full Text]
  8. Araki S, Kawahara Y, Kariya K et al. Stimulation of platelet-derived growth factor-induced DNA synthesis by angiotensin II in rabbit vascular smooth muscle cells. Biochem Biophys Res Commun 1990; 168: 350–357[CrossRef][Medline]
  9. Murakoshi N, Miyauchi T, Kakinuma Y et al. Vascular endothelin-B receptor system in vivo plays a favorable inhibitory role in vascular remodeling after injury revealed by endothelin-B receptor-knockout mice. Circulation 2002; 106: 1991–1998[Abstract/Free Full Text]
  10. Velarde V, Ullian ME, Morinelli TA, Mayfield RK, Jaffa AA. Mechanisms of MAPK activation by bradykinin in vascular smooth muscle cells. Am J Physiol 1999; 277: C253–C261[Medline]
  11. Robinson CJ, Scott PH, Allan AB et al. Treatment of vascular smooth muscle cells with antisense phosphorothioate oligodeoxynucleotides directed against p42 and p44 mitogen-activated protein kinases abolishes DNA synthesis in response to platelet-derived growth factor. Biochem J 1996; 320: 123–127[Web of Science][Medline]
  12. Miyazaki M, Sakonjo H, Takai S. Anti-atherosclerotic effects of an angiotensin converting enzyme inhibitor and an angiotensin II antagonist in Cynomolgus monkeys fed a high-cholesterol diet. Br J Pharmacol 1999; 128: 523–529[CrossRef][Web of Science][Medline]
  13. Teng J, Fukuda N, Suzuki R et al. Inhibitory effect of a novel angiotensin II type 1 receptor antagonist RNH-6270 on growth of vascular smooth muscle cells from spontaneously hypertensive rats: different anti-proliferative effect to angiotensin-converting enzyme inhibitor. J Cardiovasc Pharmacol 2002; 39: 161–171[CrossRef][Web of Science][Medline]
  14. Richter M, Richter H, Skupin M, Mohr FW, Olbrich HG. Do vascular compartments differ in the development of chronic rejection? AT(1) blocker candesartan versus ACE blocker enalapril in an experimental heart transplant model. J Heart Lung Transplant 2001; 20: 1092–1098[CrossRef][Web of Science][Medline]
  15. Wilson DP, Saward L, Zahradka P, Cheung PK. Angiotensin II receptor antagonists prevent neointimal proliferation in a porcine coronary artery organ culture model. Cardiovasc Res 1999; 42: 761–772[Abstract/Free Full Text]
  16. Bravo R, Somoza B, Ruiz-Gayo M et al. Differential effect of chronic antihypertensive treatment on vascular smooth muscle cell phenotype in spontaneously hypertensive rats. Hypertension 2001; 37: E4–E10[Web of Science][Medline]
  17. Clozel JP, Hess P, Michael C, Schietinger K, Baumgartner HR. Inhibition of converting enzyme and neointima formation after vascular injury in rabbits and guinea pigs. Hypertension 1991; 18: II55–II59[Medline]
  18. Lam JY, Lacoste L, Bourassa MG. Cilazapril and early atherosclerotic changes after balloon injury of porcine carotid arteries. Circulation 1992; 85: 1542–1547[Abstract/Free Full Text]
  19. Churchill DA, Siegel CO, Minor ST, West MS, Raizner AE. Enalapril in the prevention of restenosis following intracoronary intervention in a swine model. Coron Artery Dis 1993; 4: 461–467[Web of Science][Medline]
  20. Huber KC, Schwartz RS, Edwards WD et al. Effects of angiotensin converting enzyme inhibition on neointimal proliferation in a porcine coronary injury model. Am Heart J 1993; 125: 695–701[CrossRef][Web of Science][Medline]
  21. Jorgensen E, Kelbaek H, Helqvist S et al. Predictors of coronary in-stent restenosis: importance of angiotensin-converting enzyme gene polymorphism and treatment with angiotensin-converting enzyme inhibitors. J Am Coll Cardiol 2001; 38: 1434–1439[Abstract/Free Full Text]
Received for publication: 9. 6.04
Accepted in revised form: 20.10.04


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Nephrol Dial TransplantHome page
C. T. Chan, F. Lovren, Y. Pan, and S. Verma
Nocturnal haemodialysis is associated with improved vascular smooth muscle cell biology
Nephrol. Dial. Transplant., December 1, 2009; 24(12): 3867 - 3871.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
20/2/312    most recent
gfh606v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (1)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Wolf, S. C.
Right arrow Articles by Brehm, B. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wolf, S. C.
Right arrow Articles by Brehm, B. R.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?