Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (14)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Desvaux, D.
Right arrow Articles by Baron, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Desvaux, D.
Right arrow Articles by Baron, C.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Nephrol Dial Transplant (2004) 19: 933-939
Nephrol Dial Transplant Vol. 19 No. 4 © ERA-EDTA 2004; all rights reserved


Original Article

Acute renal allograft rejections with major interstitial oedema and plasma cell-rich infiltrates: high {gamma}-interferon expression and poor clinical outcome

Dominique Desvaux1,2, Sabine Le Gouvello3, Myriam Pastural1, Mahdi Abtahi1, Caroline Suberbielle6, Nicole Boeri4, Philippe Rémy1, Laurent Salomon5, Philippe Lang1 and Christophe Baron1

1Nephrology and Renal Transplantation Department, 2Pathology Department, 3Laboratory of Immunology, 4Etablissement Francais du Sang and 5Urology Department, Hôpital Henri Mondor, Assistance Publique-Hôpitaux de Paris, Créteil and 6Laboratory of Immunology, Hôpital Saint Louis, Assistance Publique-Hopitaux de Paris, Paris, France

Correspondence and offprint requests to: Philippe Lang, Service de Néphrologie, Hôpital Henri Mondor, 51 Avenue du Marechal de Lattre Tassigny, F-94000 Créteil, France. Email: philippe.lang{at}hmn.ap-hop-paris.fr



   Abstract
 Top
 Abstract
 Introduction
 Subjects and methods
 Results
 Discussion
 References
 
Background. Acute rejections are scored according to three main criteria: vasculitis, tubulitis and interstitial infiltration as defined in the Banff classification. Typically, B cells account for <8% of the infiltrates and oedema is limited. The clinical significance of severe interstitial oedema and plasma cell-rich infiltrates (OPcR) are still a matter of debate.

Methods. Kidney graft biopsies performed between 1991 and 1998 were retrospectively evaluated for these two criteria.

Results. Among the 826 biopsies performed during the study period, 14 samples in 12 patients met these criteria; 11 were of Banff type I acute rejection and three were borderline. Based on clinical data, all were treated as acute rejections. OPcR occurred at a median of 187 days post-transplantation. All episodes were steroid resistant. Graft survival was 40% at 1 year following the rejection. Circulating antibodies reactive either to donor HLA or to endothelial cells were present in eight of 12 patients and widespread C4d deposit in peritubular capillary were present in three out of five patients studied. Level of {gamma}-interferon mRNA within the graft was significantly higher than in standard acute cellular rejection (ACR).

Conclusion. This study showed that OPcR rejections portend a poor outcome irrespective of the Banff score. Our data strongly support the hypothesis that a humoral component participated in the graft injuries. Altogether, the data suggest that OPcR rejection might represent a late and attenuated variant of acute humoral rejection that should be classified separately from ACR.

Keywords: acute cellular rejections; humoral acute rejection; oedema and plasma cell-rich infiltrates



   Introduction
 Top
 Abstract
 Introduction
 Subjects and methods
 Results
 Discussion
 References
 
The diagnosis of renal allograft acute rejection relies primarily on the detection of organ dysfunction and on subsequent histopathological examination. Acute rejections are scored according to three main criteria: vasculitis, tubulitis and interstitial infiltration as defined in the Banff classification [1]. Interstitial infiltrates are mainly composed of T lymphocytes and monocytes/macrophages [24]; B lymphocytes account for <8% of the infiltrating cells [4]. Typically, oedema is limited and plasma cells account for <5% of the infiltrating cells [4]. During the past few years, we have observed several acute rejection episodes featuring prominent interstitial oedema and plasma cell-rich (OPcR) infiltrates (>10% of the graft infiltrating cells). Due to the low prevalence of such lesions, their place in the Banff classification remains ill defined and studies analysing their clinical significance are scarce [57]. Two of them [6,7] have pointed to the poor prognosis of PcR rejections compared with standard acute cellular rejections (ACR) with equivalent Banff scoring. Underlying reasons of this poor outcome remain obscure. Previous studies did not provide any evidence for a humoral component, but the presence of circulating antibodies has been poorly investigated.

Herein, we report 14 acute rejection episodes (in 12 patients), characterized by severe OPcR. Collectively, clinical and biological characteristics suggest that OPcR rejection might be a late and attenuated variant of humoral acute rejection (AHR) that should be classified separately from standard (ACR).



   Subjects and methods
 Top
 Abstract
 Introduction
 Subjects and methods
 Results
 Discussion
 References
 
Histopathology and immunohistochemical staining
All the kidney graft biopsies performed between 1991 and 1998 (n = 826) were evaluated. Light microscopy was performed on formalin-fixed and paraffin-embedded tissues. Sections were stained with haematoxylin and eosin (H&E), Masson-trichrome, periodic acid–Schiff (PAS) and argentic. Acute rejections were evaluated according to the Banff 97 classification. Typical plasma cells were identified by their cartwheel nuclear chromatine aspect, eccentric nuclei and eosinophilic cytoplasms. In some patients, plasmocyte infiltrates were also quantified by immunostaining with a monoclonal antibody directed to the CD138 molecule, specific of mature plasmocytes (syndecan-1, Dako, Inc.) as described by Costes et al. [8]. B-cell clonality was analysed by immunostaining with monoclonal antibodies to {kappa} and {lambda} light chain (from Dako). To analyse EBV expression, biopsies were stained with a monoclonal antibody to LMP (from Dako).

Infiltrates were designed as PcR, when plasmocytes accounted for >10% of the graft infiltrating cells. Major interstitial oedema was defined as a cortical area in which at least 10 adjacent tubuli were separated by intertubular spaces of more than one tubular diameter in width and filled with serous fluid devoid of mononuclear cells. All biopsies that met these two criteria of PcR infiltration and major interstitial oedema were included in this study.

Immuno detection of C4d
Complement fragment C4d was detected on frozen biopsies by indirect immunohistochemical staining according to a technique described previously [9]. Briefly, tissue sections were incubated in 100 µg/ml avidin D (Vector Laboratories, Burlingame, CA, USA). After washing, excess avidin was complexed by adding 10 g/ml d-biotin (Sigma Chemical Co., St Louis, MO, USA). Monoclonal antibody against complement fragment, C4d (Quidel, San Diego CA, USA) was applied for 30 min. Tissue sections were washed and incubated for 30 min with a biotinylated horse anti-mouse IgG (1/100) (Vector Laboratories) and then with FITC-streptavidin (Biomada).

Clinical and biological data
Patient age, sex, primary nephropathy, prior blood transfusion, pre-transplant panel reactive antibody (PRA), cold ischaemia time and post-transplantation events like acute tubular necrosis, rejections, infections, tumors were recorded. Plasma creatinine level, whole blood cyclosporine (CsA) level, CMV antigenaemia, circulating anti-HLA and anti-endothelial cell antibodies were regularly monitored in the post-transplantation period.

Immunosuppression and anti-rejection treatments
All patients but one received induction protocol with anti-thymoglobulins (IMTIX Pasteur-Merieux, 1.5 mg/kg/day) during 7–14 days associated with azathioprine (2 mg/kg/day) and steroids (1 mg/kg/day for 12 days and then tapered to a maintenance dose of 7–10 mg/day). CsA (or tacrolimus in one patient) was started when serum creatinine dropped below 250 µmol/l and maintained at a whole blood through level of 150–200 ng/ml as measured with a monoclonal antibody (or 8–10 ng/ml for tacrolimus). One patient, who was enrolled in a clinical trial, received an induction therapy with anti-CD7 antibody in association with steroids and CsA started on the day of transplantation.

Acute rejection episodes were treated with daily tapering pulses of methylprednisolone (10, 5, 4, 2 and 1 mg/kg/day i.v., administered from days 0–5). Steroid-resistant acute rejections were treated with either polyclonal anti-thymocyte globulins (ATG, IMTIX Pasteur-Merieux, 1.5 mg/kg/day) or OKT3 for a 7–10-day period. All acute rejection treatments were reviewed, retrospectively.

Detection of anti-HLA antibodies
Pre- and post-transplant serial serum samples were routinely collected in order to monitor humoral response. The presence of anti-HLA class I and class II was first screened by ELISA (LAT-M One Lambda Inc., St Canoga Park, CA, USA). Anti-HLA class I antibodies were also detected against a panel of phenotyped lymphocytes by anti-human globulins sensitized lymphocytotoxicity (AHG-LCT) [10]. Results were expressed as a percentage of PRA. Anti-HLA class I specificities were determined by AHG-LCT on a panel of 30 phenotyped lymphocytes selected to represent the most frequent HLA class I antigens encountered in Caucasians. When the presence of anti-HLA class II was positive by ELISA, precise identification was carried out by LCT on a panel of B lymphocytes (Lymphoscreen DR30, Biotest AG, Dreieich, Germany) after adsorption of anti-class I antibodies on a pool of 300 platelet donors. Adsorption was considered efficient when AHG-LCT became negative on a T lymphocytes panel. Antibodies to anti-endothelial cells were detected by enzyme linked immunosorbent assay on endothelial/epithelial hybridoma cell line EAHy 926 [11] according to the technique described by Heurkens et al. [12].

Quantification of {gamma}-interferon (IFN) mRNA transcripts in renal allograft biopsy specimens
{gamma}-IFN mRNA transcripts were quantified according to techniques described previously [13]. Briefly, total RNA was extracted from frozen kidney graft biopsies by using Rneasy kit (Qiagen). First strand cDNA was synthesized using 2 µg of RNA, M-MLV reverse transcriptase (16 U/µl) (Gibco BRL, USA), poly d(T) primer (Gibco BRL) and mixed dNTP (Pharmacia). Quantitative PCR were performed with the Light Cycler system as described previously by Wittwer [13]. Specific {gamma}-IFN amplification was obtained with the following combination of primers: GGTTCTCTTGGCTGTTACTGC (forward primer) and GTCATCTCGTTTCTTTTTGTTGCT (reverse primer). For fluorescence monitoring the following hybridization probes were used: GCAGAGCCAAATTGTCTCCTTTTACTTCAAACTTTTTA-fluoand Red640-CTTTAAAGATGACCAGAGCATCCAAAAGAGTGTGG-P. Quantitative DNA standards were generated as described by Lazar [14]. The magnitude of target gene expression was expressed as the number of copies per 106 copies of GAPDH cDNA (housekeeping gene). A Mann–Whitney U test was used to compare two groups.



   Results
 Top
 Abstract
 Introduction
 Subjects and methods
 Results
 Discussion
 References
 
Between 1992 and 1998, 826 kidney biopsies were performed, and 263 specimens were classified as acute rejections. Fourteen biopsy samples (in 12 patients) met the criteria of PcR infiltrates with major oedema, as defined in the Subjects and Methods section.

Pathological description of oedema and PcR infiltrates
Pathological characteristics are summarized in Table 1. Banff classification of these 14 atypical infiltrates was as follows: IA type in eight cases, IB type in three cases and borderline changes in three cases. Two patients had two OPcR rejections graded successively borderline for their first episode and IB for the recurrent one. Very mild interstitial haemorrhages were observed in four patients. Four samples featured mild glomerulitis (infiltration by mononuclear cells). Microvascular thrombosis and fibrinoid necrosis of arteries were absent. Only two patients had mild signs of chronic allograft nephropathy (graded as ci1, ct1, cv0 in the Banff classification). Cortical areas with prominent interstitial oedema were present in all samples. Plasmocytes were distributed in clusters within the renal interstitium and were never observed in the tubulitis. Plasma cells accounted for 10–40% (mean = 18) of the graft infiltrating cells, and were uniformly of mature type without nuclear atypia. All plasmocytes stained positive for expression of CD138 in the four specimens that were analysed, confirming their mature type. To explore the possibility of EBV-induced lymphoproliferation, patients without circulating anti-donor HLA antibodies were tested for EBV expression and B cell clonality by {lambda} and {kappa} light chain immunodetection, All the six biopsies were negative for LMP and express both {lambda} and {kappa} light chains.


View this table:
[in this window]
[in a new window]
 
Table 1. Pathologic characteristics of OPcR infiltrates

 
Intense and widespread C4d deposits in the peritubular capillaries were demonstrated in three of the five samples stained by immunofluorescence (in contrast, five type I pure ACR, randomly selected in our centre, were negative for C4d deposits). Based on pathological findings and clinical data (see below), all 14 samples were classified as acute rejections episodes. Thus, these atypical infiltrates accounted for 5.5% of acute rejections diagnosed in our institution.

Patients’ characteristics and clinical history prior to OPcR acute rejection
Patients’ characteristics at baseline are presented in Table 2 (age, gender, pre-sensitization, previous graft, primary kidney disease). All patients had received blood transfusions before transplantation. All patients had a negative sensitized AHG cross-match in the peak historic and current sera with both donor T and B cells. Donor–recipient HLA mismatches are shown in Table 2. Patients’ mean age was 39±12 years. Mean cold ischaemia time was 18±7 h. All kidney grafts were from cadaver donors. Four patients received combined kidney–pancreas transplantations and eight patients received kidneys (Table 2). Initial acute tubular necrosis occurred in one patient. Nine patients (75%) had been documented previously with acute rejection episodes, which occurred in the early post-transplantation period (mean 40±34 days) (Table 2). Banff scoring of their first acute rejections were of grade IA (n = 6), grade IIA (n = 1) and borderline changes (n = 2). Six were steroid-resistant but completely reversible after ATG therapy.


View this table:
[in this window]
[in a new window]
 
Table 2. Clinical patient characteristics

 
Clinical characteristics of OPcR rejections and response to therapy
OPcR rejections were diagnosed at a median of 187 days post-transplantation (range 77–280 days) and all within the first year after the transplantation (Table 3). At the time of the rejection, trough blood CsA levels were in the defined therapeutic range (100–200 ng/ml) in all patients.


View this table:
[in this window]
[in a new window]
 
Table 3. Clinical and biological characteristics of OPcR rejections

 
Mean baseline serum creatinine level, obtained 5–10 days before the OPcR rejection, was 154±50 µM, then rose sharply to 263±21 µM at the time of OPcR rejection and decreased to 241±115 µM 3 weeks after rejection treatment. These rejections were steroid-resistant in 13 of the 14 cases, requiring antilymphocyte-globulins, either ATG (n = 8) or OKT3 (n = 5). Subsequent to these treatments, three patients were switched from CsA to FK506. An immediate response was obtained in seven cases (complete in four cases and partial in three); however, response was transient in four of them. Six patients suffered from recurrent rejections within 93±75 days following the OPcR rejection (graded IA in two cases, borderline changes in two cases and two patients had a recurrent OPcR rejection).

Overall, the clinical outcome was poor (Table 3). One year after the OPcR rejection, only five patients (40%) had a functioning graft (all had a serum creatinine level >200 µM). Mean time to graft loss after the OPcR rejection was 280 days. One patient lost his graft for urological reason and another one died due to an accident. Overall, 1 and 2 years following the transplantation, graft survival rates were only 50 and 33%, respectively.

Six patients had CMV infection, all within the first 3 months post-transplant. Only one infection was concomitant with an OPcR rejection. All the others occurred at least 2 months before the index rejection episode. All CMV infections were treated with i.v. gancyclovir during 14 days. None of the patients developed a post-transplant lymphoproliferative disease during the course of the follow up.

Analysis of circulating antibodies directed to HLA or endothelial cells
An analysis of circulating antibodies directed to HLA or endothelial cells is presented in Table 3. Five patients developed donor-reactive antibodies to HLA class I or class II (two patients had isolated anti-donor class II and three had both anti-donor class I and class II). One patient developed antibodies to HLA class I without anti-donor specificity. Circulating anti-endothelial cells antibodies were identified in six out of the 11 patients analysed at the time or after OPcR rejection episode. Overall, eight out of 12 patients had circulating antibodies, which reacted to either donor HLA or endothelial cells. In addition, in one patient who did not show any reactivity against donor antigens, widespread C4d deposits were discovered in the biopsy.

Quantification of intrarenal mRNA encoding {gamma}-IFN
Five OPcR (Banff IA) and 10 classical ACR samples (Banff IA) were compared, for intragraft {gamma}-IFN gene expression. We found a significantly higher {gamma}-IFN mRNA level (P = 0.02) in OPcR (median = 71, range 35–160, expressed as number of copies per 106 copies of GAPDH cDNA) compared with standard ACR (median = 21, range 8–60). In comparison, the median level of {gamma}-IFN mRNA was 0.3 (range 0.15–0.40) in nine normal control transplant biopsies.



   Discussion
 Top
 Abstract
 Introduction
 Subjects and methods
 Results
 Discussion
 References
 
Acute renal allograft rejection typically contains T cell and macrophages infiltration, with scattered plasma cells, eosinophils and neutrophils [1]. Interstitial oedema is usually limited. Herein, we report 14 cases of renal allograft biopsies characterized by a major interstitial oedema and a PcR infiltration. This type of infiltrate was found in 1.8% of the biopsies made in our centre. This figure is close to the proportions reported by David-Neto (2.5%) [5] and Meehan (2.1%) [6].

PcR infiltrates have been reported during the course of EBV-induced post-transplantation lymphoproliferative disease (PTLD). Although the plasma cells in the cases reported here were not atypical, we further explored the possibility of EBV-induced lymphoproliferation in the six patients without circulating anti-donor-HLA antibodies. All were negative for LMP expression and none of them demonstrated light chain restriction. In addition, none of the patients developed PTLD during the course of the study. Therefore, the plasma cell infiltrates reported in the present study are probably not related to EBV infection.

Based on histopathological features and clinical data, all samples were classified as acute rejections, accounting for 5.5% of the rejections diagnosed in our centre. In addition, these lesions were never observed in biopsies that showed no signs of acute rejection.

Due to the low prevalence of OPcR rejections, it is difficult to assess the possible risk factors. Nevertheless, in our study, it was striking to note that four of the 12 patients (33%) had received combined kidney and pancreas grafts, while only 11 such combined transplantations were performed at our department during this period (accounting for 2% of our transplant activity). This observation would suggest that patients with a combined kidney/pancreas transplantation may be at risk to develop such OPcR rejections. Tapering immunosuppression has been occasionally associated with the onset of PcR infiltration [1]. However, at the time of rejection, trough blood CsA levels were in the defined therapeutic range in all patients.

The clinical and physiopathological significance of PcR infiltrates have been rarely addressed and are still a matter of debate. Only two previous studies have analysed rejections with PcR infiltrates [6,7]. Six months after the rejection, they both reported graft survival rates of 44 and 53%, respectively. These rates were much lower than in their group of control rejections matched for the Banff scoring. In our study, similar survival rates were reported: 42% of the grafts failed within 6 months, and all of the surviving grafts had chronic renal dysfunction. This poor prognosis, despite intensive treatments with anti-globulins, strikingly contrasted with the mild histopathological signs of rejection (11/14 were scored grade IA or less). Several studies [1517], analysing standard acute rejection, have reported a good correlation between rejection reversibility and the grade in the Banff scoring. In our study, complete response (in the short term) was obtained in only 28% of the cases, a much lower proportion than in grade IA standard acute rejections [17]. Collectively, the data strongly suggest that PcR infiltrates per se indicate a poor outcome, irrespective of the histopathological severity assessed by the Banff scoring. This sharp contrast raises the possibility that OPcR infiltrates might indicate an antibody-mediated component in the rejection. So far, diagnosis of AHR has been problematic because universal and pathognomonic features have not been definitively established. At present, the diagnosis is raised by the identification of suspicious pathologic features on biopsies (such as glomerular and small vessel thrombosis, marginated polymorphonuclear leukocytes in peritubular and glomerular capillaries, fibrinoid necrosis and severe vasculatis) and the subsequent identification of circulating anti-donor antibodies [18]. Recently, C4d deposition in the peritubular capillaries was added to the criteria for antibody-mediated rejection [19]. Morphologic features suggestive of AHR were absent in our samples as well as in the two other previous studies on PcR rejections [6,7]. However, mild interstitial haemorrhages, suggestive of vascular damage, were present in 29% of our patients and in 69% in the Meehan's study [6]. So far, circulating antibodies in patients with PcR rejections, have been poorly investigated: the prevalence of circulating antibodies to donor-HLA class II or to endothelial cells has never been analysed, and reactivity to donor HLA class I was reported in only one of 15 patients by Charney [7], who used a low sensitive standard LCT technique. In contrast, in our study, five of 12 patients developed reactivity to donor HLA, as detected by an anti-human globulin sensitized LCT test and six patients had circulating anti-endothelial cells antibodies. Overall, eight of 12 patients (67%) had circulating antibodies, potentially reactive to donor antigens. The ability of anti-HLA in mediating renal injuries is well established [20,21], but the role of anti-endothelial cells antibodies remains controversial. However, the correlation between the presence of anti-endothelial cell antibodies and AHR has been recognized by several authors in heart [22] and kidney transplantation as well [23]. Recent studies have identified the non-classical HLA molecules, MICA (for MHC class I-related chain A), expressed on endothelial cells, as targets for humoral immunity associated with irreversible rejections of kidney allografts [24,25]. In addition, in the present study, C4d deposits in the peritubular capillary (PTC), suggestive of antibody-mediated injuries [19], were found in three to five patients, including one patient without circulating anti-donor antibodies. Overall, nine to 12 patients (75%) had signs suggesting an antibody-mediated rejection. Keeping in mind that measuring the circulating antibodies usually underestimates the frequency of AHR [18], our results strongly suggest that an antibody-mediated mechanism was involved in most of the OpcR rejections. Thus, these rejections appear to be a variant of late and attenuated AHR.

The striking contrast between the constant absence of histopathological signs of AHR despite the presence of circulating anti-donor antibodies lead us to analyse the molecular microenvironment in OPcR biopsies by quantitative real time PCR. Several recent animal studies by Halloran et al. [26] have shown that intense local production of {gamma}-IFN in rejecting kidney allografts attenuated the rejection process and prevented thrombosis, micro vessel injuries, PTC congestion and necrosis by acting at the level of the microcirculation. Therefore we decided to assess intragraft gene expression of {gamma}-IFN, in five patients with OpcR. Compared with standard acute rejections of the same grade in the Banff classification (IA), we found a significantly higher local expression of {gamma}-IFN in OpcR rejections. We hypothesized that this high {gamma}-IFN expression might have attenuated the histological and clinical expression of the antibody-mediated injuries, as suggested by the rodent models. Therefore, OPcR findings on biopsies, during an acute rejection, should prompt us to look carefully for circulating anti-donor antibodies and PTC C4d deposits, in order to use appropriate treatments.

In conclusion, our study indicates that acute rejections associated with prominent interstitial OPcR infiltrates are highly resistant to therapy and portend a poor outcome, irrespective of the Banff score. These lesions account for 5.5% of rejection episodes but are more frequent in combined kidney/pancreas grafts. Our study provides some evidence that renal injury is likely to be antibody-mediated. Finally, we unravelled a high {gamma}-IFN expression that might explain the sharp contrast between the mild histopathological signs of rejection and the poor outcome. Taken together, pathological, molecular and clinical data strongly support the proposal that OPcR rejection should be recognized as a distinct entity that deserves further investigations in larger groups of patients in order to evaluate the most appropriate treatment.

Conflict of interest statement. None declared.



   References
 Top
 Abstract
 Introduction
 Subjects and methods
 Results
 Discussion
 References
 

  1. Racusen LC, Solez K, Colvin RB et al. The Banff 97 working classification of renal allograft pathology. Kidney Int 1999; 55: 713–723[CrossRef][ISI][Medline]
  2. Hall BM, Bishop GA, Farnsworth A et al. Identification of the cellular subpopulations infiltrating rejecting cadaver renal allografts. Preponderance of the T4 subset of T cells. Transplantation 1984; 37: 564–570[Medline]
  3. Platt JL, LeBien TW, Michael AF. Interstitial mononuclear cell populations in renal graft rejection. Identification by monoclonal antibodies in tissue sections. J Exp Med 1982; 155: 17–30[Abstract/Free Full Text]
  4. Hancock WW, Thomson NM, Atkins RC. Composition of interstitial cellular infiltrate identified by monoclonal antibodies in renal biopsies of rejecting human renal allografts. Transplantation 1983; 35: 458–463[Medline]
  5. David-Neto E, Ribeiro DS, Ianhez LE et al. Acute interstitial nephritis of plasma cells: a new cause for renal allograft loss. Transplant Proc 1993; 25: 897–899[Medline]
  6. Meehan SM, Domer P, Josephson M et al. The clinical and pathologic implications of plasmacytic infiltrates in percutaneous renal allograft biopsies. Hum Pathol 2001; 32: 205–215[CrossRef][Medline]
  7. Charney DA, Nadasdy T, Lo AW, Racusen LC. Plasma cell-rich acute renal allograft rejection. Transplantation 1999; 68: 791–797[CrossRef][Medline]
  8. Costes V, Magen V, Legouffe E et al. The Mi15 monoclonal antibody (anti-syndecan-1) is a reliable marker for quantifying plasma cells in paraffin-embedded bone marrow biopsy specimens. Hum Pathol 1999; 30: 1405–1411[CrossRef][Medline]
  9. Collins AB, Schneeberger EE, Pascual MA et al. Complement activation in acute humoral renal allograft rejection: diagnostic significance of C4d deposits in peritubular capillaries. J Am Soc Nephrol 1999; 10: 2208–2214[Abstract/Free Full Text]
  10. Fuller TC, Phelan D, Gebel HM, Rodey GE. Antigenic specificity of antibody reactive in the antiglobulin-augmented lymphocytotoxicity test. Transplantation 1982; 34: 24–29[Medline]
  11. Edgell CJ, McDonald CC, Graham JB. Permanent cell line expressing human factor VIII-related antigen established by hybridization. Proc Natl Acad Sci USA 1983; 80: 3734–3737[Abstract/Free Full Text]
  12. Heurkens AH, Hiemstra PS, Lafeber GJ, Daha MR, Breedveld FC. Anti-endothelial cell antibodies in patients with rheumatoid arthritis complicated by vasculitis. Clin Exp Immunol 1989; 78: 7–12[Medline]
  13. Wittwer CT, Herrmann MG, Moss AA, Rasmussen RP. Continuous fluorescence monitoring of rapid cycle DNA amplification. Biotechniques 1997; 22: 130–131, 134–138
  14. Lazar JG. Advanced methods in PCR product detection. PCR Methods Appl 1994; 4: S1–14[Medline]
  15. Mueller A, Schnuelle P, Waldherr R, van der Woude FJ. Impact of the Banff ‘97 classification for histological diagnosis of rejection on clinical outcome and renal function parameters after kidney transplantation. Transplantation 2000; 69: 1123–1127[CrossRef][Medline]
  16. Macdonald FI, Ashraf S, Picton M et al. Banff criteria as predictors of outcome following acute renal allograft rejection. Nephrol Dial Transplant 1999; 14: 1692–1697[Abstract/Free Full Text]
  17. Gaber LW, Moore LW, Alloway RR et al. Correlation between Banff classification, acute renal rejection scores and reversal of rejection. Kidney Int 1996; 49: 481–487[ISI][Medline]
  18. Mauiyyedi S, Crespo M, Collins AB et al. Acute humoral rejection in kidney transplantation: II. Morphology, immunopathology, and pathologic classification. J Am Soc Nephrol 2002; 13: 779–787[Abstract/Free Full Text]
  19. Mauiyyedi S, Colvin RB. Humoral rejection in kidney transplantation: new concepts in diagnosis and treatment. Curr Opin Nephrol Hypertens 2002; 11: 609–618[CrossRef][Medline]
  20. Trpkov K, Campbell P, Pazderka F et al. Pathologic features of acute renal allograft rejection associated with donor-specific antibody. Analysis using the Banff grading schema. Transplantation 1996; 61: 1586–1592[CrossRef][ISI][Medline]
  21. Halloran PF, Schlaut J, Solez K, Srinivasa NS. The significance of the anti-class I response. II. Clinical and pathologic features of renal transplants with anti-class I-like antibody. Transplantation 1992; 53: 550–555[ISI][Medline]
  22. Fredrich R, Toyoda M, Czer LS et al. The clinical significance of antibodies to human vascular endothelial cells after cardiac transplantation. Transplantation 1999; 67: 385–391[CrossRef][ISI][Medline]
  23. Yard B, Spruyt-Gerritse M, Claas F et al. The clinical significance of allospecific antibodies against endothelial cells detected with an antibody-dependent cellular cytotoxicity assay for vascular rejection and graft loss after renal transplantation. Transplantation 1993; 55: 1287–1293[Medline]
  24. Sumitran-Holgersson S, Wilczek HE, Holgersson J, Soderstrom K. Identification of the nonclassical HLA molecules, mica, as targets for humoral immunity associated with irreversible rejection of kidney allografts. Transplantation 2002; 74: 268–277[CrossRef][Medline]
  25. Zwirner NW, Marcos CY, Mirbaha F, Zou Y, Stastny P. Identification of MICA as a new polymorphic alloantigen recognized by antibodies in sera of organ transplant recipients. Hum Immunol 2000; 61: 917–924[CrossRef][Medline]
  26. Halloran PF, Miller LW, Urmson J et al. IFN-gamma alters the pathology of graft rejection: protection from early necrosis. J Immunol 2001; 166: 7072–7081[Abstract/Free Full Text]
Received for publication: 20.12.02
Accepted in revised form: 5.11.03


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?



This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (14)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Desvaux, D.
Right arrow Articles by Baron, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Desvaux, D.
Right arrow Articles by Baron, C.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?