Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (17)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Linthorst, G. E.
Right arrow Articles by Boeschoten, E. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Linthorst, G. E.
Right arrow Articles by Boeschoten, E. W.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Nephrol Dial Transplant (2003) 18: 1581-1584
© 2003 European Renal Association-European Dialysis and Transplant Association

{alpha}-Galactosidase A deficiency in Dutch patients on dialysis: a critical appraisal of screening for Fabry disease

Gabor E. Linthorst1, Carla E. M. Hollak1, Johanna C. Korevaar2, Jeanette G. van Manen3, Johannes M. F. G. Aerts4 and Els W. Boeschoten5

1 Department of Internal Medicine, Clinical Haematology, 2 Department of Clinical Epidemiology and Biostatistics, Academic Medical Center, Amsterdam, 3 Department of Clinical Epidemiology, Leiden University Medical Center, Leiden, 4 Department of Biochemistry, Academic Medical Center and 5 Dianet Dialysis Center, Academic Medical Center, Amsterdam, The Netherlands

Correspondence and offprint requests to: G. E. Linthorst, Academic Medical Center, Department of Internal Medicine, Clinical Haematology, F4-224, Meibergdreef 9, 1105 AZ Amsterdam, The Netherlands. Email: g.e.linthorst{at}amc.uva.nl



   Abstract
 Top
 Abstract
 Introduction
 Subjects and methods
 Results
 Discussion
 Conclusion
 References
 
Introduction. Fabry disease or {alpha}-galactosidase A ({alpha}-Gal A) deficiency is an X-linked lysosomal storage disorder that often leads to renal insufficiency in males and occasionally in females. The disease is rare, but its prevalence may be underestimated due to its variable clinical picture. Enzyme supplementation therapy with rHu-{alpha}Gal A is currently available. Limited experience has so far shown that therapy may at best stabilize renal function. Despite these preliminary findings, much effort is being put into screening high-risk groups for undiagnosed {alpha}-Gal A deficiency. We studied the prevalence of {alpha}-Gal A deficiency in a Dutch dialysis cohort to establish possible underdiagnosis. We discuss the benefits of screening for Fabry disease.

Methods. Activity of {alpha}-Gal A in whole blood was measured in a group of 508 male Dutch dialysis patients.

Results. Of the 508 patients studied only one patient, already known with Fabry disease, had a {alpha}-Gal A deficiency, a prevalence of 0.22% (95 CI 0–1.1%).

Conclusions. No undiagnosed Fabry patients were found, indicating that in our studied cohort there is no large-scale underestimation of its prevalence. Even though screening of dialysis patients for Fabry disease might identify patients who remain otherwise unrecognized, screening of high-risk populations for {alpha}-Gal A deficiency should be carried out with caution since long-term efficacy of treatment is currently unknown.

Keywords: Fabry disease; {alpha}-galactosidase A; lysosomal storage disorder; prevalence; screening



   Introduction
 Top
 Abstract
 Introduction
 Subjects and methods
 Results
 Discussion
 Conclusion
 References
 
Fabry disease is an X-linked disorder caused by a deficiency of the lysosomal enzyme {alpha} galactosidase A ({alpha}-Gal A), resulting in accumulation of specific glycosphingolipids in (vascular) endothelial cells. In childhood, males suffer from severe pains in hands and feet (acroparaesthesias), hypohydrosis or anhydrosis, and develop angiokeratoma in trunk and genitals. Later in life these affected males develop vascular complications due to the ongoing endothelial glycolipid accumulation, of which renal insufficiency, often progressing to end-stage renal failure requiring dialysis, is a major feature [1]. The clinical picture of the disorder is highly variable. In female carriers the clinical picture is even more heterogeneous, albeit with a more protracted course.

It is possible that due to its variability in clinical expression, the above-mentioned symptoms are not always recognized as Fabry disease, resulting in underdiagnosis and consequently underestimation of its prevalence. The prevalence of Fabry disease in large dialysis registry programmes was shown to be 0.019 and 0.017%, in Europe and the US, respectively [2,3]. Reports on the prevalence of Fabry disease in such registries depend on a correct diagnosis. In contrast, Utsumi et al. [4] diagnosed Fabry disease in two of 440 males (0.45%) with renal failure in Japan. Given 2700 male dialysis patients in The Netherlands [5], such prevalence indicates that there could be around 12 Fabry patients on dialysis. Currently only one dialysis patient is known to have Fabry disease. Therefore, there is reason to believe that an underestimation of the actual number of patients is made in dialysis registries.

Studying the prevalence of Fabry disease in The Netherlands may be relevant, as enzyme supplementation therapy for Fabry disease is currently available in the EU [6,7]. Whether dialysis patients can benefit from enzyme therapy is unknown. The aim of the present study was to screen the number of Fabry patients by detection of {alpha}-Gal A deficiency in a Dutch cohort of dialysis patients (Netherlands Cooperative Study on the Adequacy of Dialysis). In addition, conditions for successful and beneficial screening for Fabry disease in high-risk groups will be discussed.



   Subjects and methods
 Top
 Abstract
 Introduction
 Subjects and methods
 Results
 Discussion
 Conclusion
 References
 
Dialysis patients
Patients participated in the Netherlands Cooperative Study on the Adequacy of Dialysis (NECOSAD-2), a large multi-centre prospective study [8]. This study aims to monitor the quality and adequacy of dialysis treatment in The Netherlands. Eligibility criteria for participation in the NECOSAD study were: >= 18 years of age, no previous renal replacement therapy, and written informed consent. The NECOSAD database consists of over 1500 patients on either peritoneal dialysis or haemodialysis. EDTA anticoagulated blood from 508 male patients, taken between January 2000 and April 2002, was available for determination of {alpha}-Gal A activity. Female dialysis patients were excluded as enzyme activity for diagnosing female Fabry carriers is unreliable because of overlap with normal controls. Males with Fabry disease usually have absent to very low {alpha}-Gal A activity and can be detected reliably. Samples had been frozen as whole blood at –20°C until use. One patient in the NECOSAD registry had a pre-emptive diagnosis of Fabry disease and was included in this study. All patients had given informed consent to donate blood for scientific research. Determination of {alpha}-Gal A activity was performed anonymously.

Determination of {alpha}-Gal A activity
EDTA blood tubes were thawed and 25 µl of EDTA whole blood was incubated for 2 h in tubes containing 100 µl 1.5 mg/ml 4-MU {alpha}-galactosylpyranoside and 100 mmol N-acetyl-galactosamine (both Sigma) in pH 4.5 McIlvain buffer. Samples were measured in duplicate. The reaction was stopped by adding 2.3 ml 0.3 M glycine Na-OH, pH 10.6. Fluorescence was measured using a fluorometer (exciting 360 nm reading 445 nm). Results were expressed as means ± SD.

Role of quenching
To exclude the possibility that haemoglobin from thawed samples could mask fluorescence (so-called quenching) and subsequently give false-negative fluorescence, an EDTA anticoagulated whole blood sample from one known Fabry patient on haemodialysis was frozen. Upon thawing this sample was mixed with known concentrations of 4-MU and fluorescence was measured as described above.

DNA-mutation analysis
From 400 µl of whole blood DNA was isolated. All 7 exons of the {alpha}-Gal A gene were sequenced using the following primers. Exon 1, GGTGATTGGTTAGCGGAACGTCTT (sense, sequence-reaction exon 1) and GAGCTCTCCCTC GGGCTCAACT (antisense). Exon 2, ACTACCACAC TATTACTGGGTTGGA (sense, sequence-reaction exon 2) and TGTTCAGATAACAGCCAGCTATTCTA (antisense). Exons 3–4, CAATACCTGGTGAAGTAACC TTGTC (sense, sequence reaction exon 3) and GGAACC TGGGAGAGATGGTAGGAT (antisense, sequence-reaction exon 4). Exon 5–7, GACCTCCTTATGGA GACGTTCAATC (sense, sequence-reaction exon 5) and CGGAAAATTTTATTCAAGGAAATAGAAC (antisense), TGTTTCTAGCAAGAAGCTTTATTACTG (sequence-reaction exon 6) and GAGCCACCTAGCC TTGAG (sequence-reaction exon 7).



   Results
 Top
 Abstract
 Introduction
 Subjects and methods
 Results
 Discussion
 Conclusion
 References
 
{alpha}-Gal A deficiency in dialysis patients
A total of 508 male patients were analysed. Mean {alpha}-Gal A activity was 19.75 ± 8.9 nmol/ml whole blood/h (range 0.5–55.4) (see Figure 1). One patient had an {alpha}-Gal A activity of 0.5 nmol/ml whole blood/h, which was less than the mean minus 2x SD (activity below 1.9 nmol/ml whole blood/h). This corresponds with a prevalence of 0.20% (95% CI 0–1.1%).



View larger version (15K):
[in this window]
[in a new window]
 
Fig. 1. {alpha}-Gal A activity in 508 male patients on dialysis.

 
Mutation analysis of the {alpha}-Gal A gene of this patient identified a C to G transition at position 10 605 in exon 6, resulting in an amino-acid change from aspartic acid to glutamate at position 299. The patient with a pre-emptive diagnosis of Fabry disease was known to have this mutation. The next lowest measured {alpha}-Gal A activity was still > 35% of the mean, making a false-negative result (missed {alpha}-Gal A deficiency) highly unlikely, even in the presence of a mutation.

Quenching
Incubation of 4-MU with increasing amounts of whole blood from one Fabry-patient on dialysis reduced fluorescence with a maximum of 40% when 25 µl of blood was incubated. Even if a reduced fluorescence of 40% were taken into account in the patient with reduced {alpha}-Gal A activity, no overlap existed between the {alpha}-Gal A deficient patient and other subjects. Therefore, the risk of detecting false-positive results (no fluorescence due to the quenching phenomenon) was be negligible.



   Discussion
 Top
 Abstract
 Introduction
 Subjects and methods
 Results
 Discussion
 Conclusion
 References
 
In the present study of 508 male dialysis patients, deficiency of {alpha}-Gal A in whole blood was detected in one patient already identified as having Fabry disease, corresponding with a prevalence of 0.20% (95% CI 0–1.1). So in this cohort no previously undiagnosed Fabry patients were detected.

Assessment of {alpha}-Gal A activity is preferably performed in leukocytes. However, sometimes other sources are used, such as dried whole blood spots, serum or plasma [9,10]. As it is unclear whether these sources are as reliable as leukocytes, enzymatic results must be confirmed by genotyping. For our study only frozen whole blood samples were available. We showed that absorbance of fluorescence by haemoglobin (quenching) when using whole blood as source did not influence the test results. In addition, mutation analysis confirmed test outcome by confirmation with mutation analysis.

The observed prevalence in this study is in accordance with previous reports. Utsumi et al. [4] found two patients out of 406 Japanese male (0.49%) and 0/282 female dialysis patients using plasma as source. From one patient DNA was available and diagnosis was confirmed by mutation analysis of the {alpha}-Gal A gene. In addition, Walter and co-workers [11] detected nine deficient {alpha}-Gal A plasma levels taken from 1903 randomly chosen male dialysis patients in the US (0.47%). Spada and Pagliardini [12] identified {alpha}-Gal A deficiency in dried whole blood spots in 4/1765 (0.22%) Italian males and 0/1226 female patients on dialysis. Deficiency of {alpha}-Gal A was confirmed by mutation analysis in all patients in both studies.

These results indicate that Fabry disease may be much more common among male dialysis patients than previously recognized through dialysis registries [2,3]. Apparently, Fabry disease is seldom recognized as a cause of renal failure and is subsequently possibly under-diagnosed. Subsequently, Fabry disease should be considered in every patient with unexplained renal disease, especially when cardiac or cerebral complications suggest an underlying multi-systemic disorder. In males Fabry disease can reliably be diagnosed by {alpha}-Gal A activity determination. This could then be followed by screening of family members for Fabry disease, in whom progression of renal failure or other organ failure due to the disease may be detected at an earlier stage, enabling appropriate intervention. These arguments are in favour of screening all patients with unexplained renal failure for {alpha}-Gal A deficiency.

However, it is important for successful and beneficial screening to meet well-defined criteria [13]. These are a well-defined and understood disease with known natural history and effective treatment, a reliable test and finally an agreement on the action taken following a positive result. In Fabry disease, these criteria are not currently met. First of all, enzymatic analysis fails to detect all female carriers of the disease. It is now well recognized that females can also exhibit symptoms due to Fabry disease [14]. This is confirmed by the observation that 12% of the Fabry patients on dialysis are female [2,3]. Detection of female carriers can only be reliably performed with DNA-mutation analysis. Reports on enzymatic screening dialysis patients that fail to detect female carriers of Fabry disease may lead to the false assumption that {alpha}-Gal A deficiency does not occur in female dialysis patients. Second, the positive outcome of long-term therapeutic intervention for patients with Fabry disease still has to be substantiated. Studies with recombinant {alpha}-Gal A enzyme supplementation therapy have shown a stabilization of renal function during 3 years of therapy, the longest period studied. It is unclear if patients on dialysis have a more favourable outcome whether treated or not, although it is anticipated that enzyme supplementation therapy will reduce co-morbidity arising from other involved organs. At last, mass screening patients routinely for {alpha}-Gal A deficiency places a moral dilemma for screened individuals and family members, given the inheritable nature of the disorder. Therefore, it is our view that screening of high-risk populations should be used with caution until further insight into the nature of and treatment for Fabry disease has progressed.



   Conclusion
 Top
 Abstract
 Introduction
 Subjects and methods
 Results
 Discussion
 Conclusion
 References
 
In a cohort of 508 Dutch male dialysis patients {alpha}-Gal A deficiency was detected in one patient already known to suffer from Fabry disease. Despite this, screening of dialysis patients for Fabry disease might identify patients who remain otherwise unrecognized. However, since criteria for successful and beneficial screening are currently not met, screening should be carried out with great caution.



   Acknowledgments
 
The nursing staff of the dialysis centres, who collected most of the data, are gratefully acknowledged for their assistance. This work was supported by grants from The Dutch Kidney Foundation (E.018) and the Dutch National Health Insurance Board (OG97/005).

Conflict of interest statement. None declared.



   References
 Top
 Abstract
 Introduction
 Subjects and methods
 Results
 Discussion
 Conclusion
 References
 

  1. Desnick RJ, Ioannou YA, Eng ME. {alpha}-Galactosidase A deficiency: Fabry disease. In: Scriver CR, Beaudet AL, Sly WS, Valle D, eds. The Metabolic and Molecular Bases of Inherited Disease. 8th edn.Vol. 3. New York, McGraw-Hill 2001;3733–3774
  2. Tsakiris D, Simpson HK, Jones EH et al. Report on management of renal failure in Europe, XXVI, 1995. Rare diseases in renal replacement therapy in the ERA–EDTA Registry. Nephrol Dial Transplant 1996; 11 [Suppl 7]: 4–20[Medline]
  3. Thadhani R, Wolf M, West ML et al. Patients with Fabry disease on dialysis in the United States. Kidney Int 2002; 61: 249–255[CrossRef][Web of Science][Medline]
  4. Utsumi K, Kase R, Takata T et al. Fabry disease in patients receiving maintenance dialysis. Clin Exp Nephrol 1999; 4: 49–51
  5. Renine, the comprehensive Dutch dialysis registry. Statistical report 2002. 1–1–2002
  6. Eng CM, Guffon N, Wilcox WR et al. Safety and efficacy of recombinant human {alpha}-galactosidase A replacement therapy in Fabry’s disease. N Engl J Med 2001; 345: 9–16[Abstract/Free Full Text]
  7. Schiffmann R, Kopp JB, Austin HA, III et al. Enzyme replacement therapy in Fabry disease: a randomized controlled trial. JAMA 2001; 285: 2743–2749[Abstract/Free Full Text]
  8. Termorshuizen F, Korevaar JC, Dekker F et al. Time trends in initiation and dose of dialysis in end-stage renal disease patients in the Netherlands. Nephrol Dial Transplant 2003; 18: 552–558[Abstract/Free Full Text]
  9. Spence MW, Goldbloom AL, Burgess JK et al. Heterozygote detection in angiokeratoma corporis diffusum (Anderson–Fabry disease). Studies on plasma, leucocytes, and hair follicles. J Med Genet 1977; 14: 91–99[Abstract/Free Full Text]
  10. Desnick RJ, Allen KY, Desnick SJ et al. Fabry’s disease: enzymatic diagnosis of hemizygotes and heterozygotes. Alpha-galactosidase activities in plasma, serum, urine, and leukocytes. J Lab Clin Med 1973; 81: 157–171[Web of Science][Medline]
  11. Walters BAJ, Prichard M, McCardle H, Richards SM, Bosch JP. Prevalence of reduced plasma {alpha}-galactosidase activity in a cohort of male patients on hemodialysis (HO) in the United States. Abstract, Annual Clinical Genetics Meeting, of the American College of Medical Genetics, March 2002
  12. Spada M, Pagliardini S. Screening for Fabry disease in end-stage nephropathies. J Inher Metabol Dis 2002; 25 [Suppl I]: 113
  13. Grimes DA, Schulz KF. Uses and abuses of screening tests. Lancet 2002; 359: 881–884[CrossRef][Web of Science][Medline]
  14. MacDermot KD, Holmes A, Miners AH. Anderson–Fabry disease: clinical manifestations and impact of disease in a cohort of 60 obligate carrier females. J Med Genet 2001; 38: 769–775[Free Full Text]
Received for publication: 2. 1.03
Accepted in revised form: 21. 2.03


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Nephrol Dial TransplantHome page
B. Oqvist, B. M. Brenner, J. P. Oliveira, A. Ortiz, R. Schaefer, E. Svarstad, C. Wanner, K. Zhang, and D. G. Warnock
Nephropathy in Fabry disease: the importance of early diagnosis and testing in high-risk populations
Nephrol. Dial. Transplant., June 1, 2009; 24(6): 1736 - 1743.
[Full Text] [PDF]


Home page
Nephrol Dial TransplantHome page
G. D. Schoenmakere, B. Poppe, B. Wuyts, K. Claes, D. Cassiman, B. Maes, D. Verbeelen, R. Vanholder, D. R. Kuypers, N. Lameire, et al.
Two-tier approach for the detection of alpha-galactosidase A deficiency in kidney transplant recipients
Nephrol. Dial. Transplant., December 1, 2008; 23(12): 4044 - 4048.
[Abstract] [Full Text] [PDF]


Home page
Nephrol Dial TransplantHome page
W. Terryn, B. Poppe, B. Wuyts, K. Claes, B. Maes, D. Verbeelen, R. Vanholder, K. De Boeck, N. Lameire, A. De Paepe, et al.
Two-tier approach for the detection of alpha-galactosidase A deficiency in a predominantly female haemodialysis population
Nephrol. Dial. Transplant., January 1, 2008; 23(1): 294 - 300.
[Abstract] [Full Text] [PDF]


Home page
CJASNHome page
J. Andrade, P. J. Waters, R. S. Singh, A. Levin, B.-C. Toh, H. D. Vallance, and S. Sirrs
Screening for Fabry Disease in Patients with Chronic Kidney Disease: Limitations of Plasma {alpha}-Galactosidase Assay as a Screening Test
Clin. J. Am. Soc. Nephrol., January 1, 2008; 3(1): 139 - 145.
[Abstract] [Full Text] [PDF]


Home page
Nephrol Dial TransplantHome page
M. Merta, J. Reiterova, J. Ledvinova, H. Poupetova, R. Dobrovolny, R. Rysava, D. Maixnerova, J. Bultas, J. Motan, J. Slivkova, et al.
A nationwide blood spot screening study for Fabry disease in the Czech Republic haemodialysis patient population
Nephrol. Dial. Transplant., January 1, 2007; 22(1): 179 - 186.
[Abstract] [Full Text] [PDF]


Home page
Clin. Chem.Home page
M. Fuller, P. C. Sharp, T. Rozaklis, P. D. Whitfield, D. Blacklock, J. J. Hopwood, and P. J. Meikle
Urinary Lipid Profiling for the Identification of Fabry Hemizygotes and Heterozygotes
Clin. Chem., April 1, 2005; 51(4): 688 - 694.
[Abstract] [Full Text] [PDF]


Home page
Clin. Chem.Home page
M. Fuller, M. Lovejoy, D. A. Brooks, M. L. Harkin, J. J. Hopwood, and P. J. Meikle
Immunoquantification of {alpha}-Galactosidase: Evaluation for the Diagnosis of Fabry Disease
Clin. Chem., November 1, 2004; 50(11): 1979 - 1985.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
P. Kotanko, R. Kramar, D. Devrnja, E. Paschke, T. Voigtlander, M. Auinger, K. Demmelbauer, M. Lorenz, A.-C. Hauser, H.-J. Kofler, et al.
Results of a Nationwide Screening for Anderson-Fabry Disease among Dialysis Patients
J. Am. Soc. Nephrol., May 1, 2004; 15(5): 1323 - 1329.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (17)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Linthorst, G. E.
Right arrow Articles by Boeschoten, E. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Linthorst, G. E.
Right arrow Articles by Boeschoten, E. W.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?