Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (21)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Calò, L. A.
Right arrow Articles by Semplicini, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Calò, L. A.
Right arrow Articles by Semplicini, A.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Nephrol Dial Transplant (2003) 18: 1518-1525
© 2003 European Renal Association-European Dialysis and Transplant Association

Oxidative stress-related factors in Bartter’s and Gitelman’s syndromes: relevance for angiotensin II signalling

Lorenzo A. Calò1, Elisa Pagnin1, Paul A. Davis2, Michelangelo Sartori1 and Andrea Semplicini1

1 Department of Clinical and Experimental Medicine, Clinica Medica 4, University of Padova, Italy and 2 Department of Internal Medicine-Clinical Nutrition, University of California, Davis, CA, USA

Correspondence and offprint requests to: Lorenzo A. Calò, MD, Department of Clinical and Experimental Medicine, Clinica Medica 4, University of Padova, Via Giustiniani, 2, 35128 Padova, Italy. Email: renzcalo{at}unipd.it



   Abstract
 Top
 Abstract
 Introduction
 Subjects and methods
 Results
 Discussion
 References
 
Background. Bartter’s and Gitelman’s syndromes (BS/GS) have a blunted Gq protein-mediated cell signalling despite high circulating angiotensin II (Ang II) levels. This is associated with reduced G{alpha}q gene expression, intracellular inositol trisphosphate and Ca++ release, PKC activity and cell reactivity. Ang II is a powerful stimulator of vascular oxidases but BS/GS patients show reduced total volatile LDL oxidation products and reduced LDL susceptibility to oxidation suggesting low level of oxidative stress. Therefore, we evaluated oxidative stress-related proteins in plasma and monocytes of patients with BS/GS, at baseline and after Ang II stimulation.

Methods. In two BS and seven GS patients, biochemically and genetically characterized, and in 10 age- and sex-matched control subjects, we measured total plasma antioxidant power (AOP), plasma peroxynitrite level and gene expression of the NADH/NADPH oxidase subunit p22phox, TGFß and haeme oxygenase-1 (HO-1) in circulating monocytes in basal condition and after stimulation with Ang II. Furthermore, we investigated the C242T polymorphism of p22phox, whose topography in a potential haeme-binding site suggests a role in the regulation of oxidative stress.

Results. AOP was higher in BS/GS patients than in controls (3.27 ± 0.95 mmol/l vs 1.05 ± 0.16, P = 0.002), together with higher plasma renin activity and aldosterone level (9.88 ± 4.64 vs 0.95 ± 0.08 nmol Ang I/h/ml, P < 0.0001; and 0.73 ± 0.13 vs 0.18 ± 0.01 nmol/l, P < 0.0001, respectively). The plasma peroxynitrite level was undetectable both in patients and controls. mRNA expression of p22phox and TGFß was reduced in BS/GS patients compared to controls [0.35 ± 0.08 vs 0.53±0.05 densitometric units (d.u.), P = 0.005, and 0.82 ± 0.07 vs 1.15 ± 0.25 d.u., P = 0.006, respectively]. HO-1 mRNA was increased in BS/GS patients in comparison to controls (0.88 ± 0.07 vs 0.78 ± 0.11 d.u., P = 0.037). After acute Ang II exposure, p22phox, TGFß and HO-1 gene expression significantly increased only in controls (from 0.59 ± 0.12 to 0.96 ± 0.11, P < 0.001, from 0.97 ± 0.1 to 1.27 ± 0.22, P < 0.008, and from 0.62 ± 0.1 to 0.82 ± 0.09, P < 0.001, respectively). Finally, C242T polymorphism of p22phox was undetectable.

Conclusions. The intracellular responses to Ang II mediated by reactive oxygen species are reduced in BS/GS patients. This may contribute to their vascular hyporeactivity.

Keywords: angiotensin II; atherosclerosis; signal transduction; vasoactive agents; vasoconstriction/dilation



   Introduction
 Top
 Abstract
 Introduction
 Subjects and methods
 Results
 Discussion
 References
 
The clinical picture of Bartter’s and Gitelman’s syndromes (BS/GS) reflects genetically determined functional defects of kidney transporters and ion channels, leading to a puzzling clinical picture characterized by hypokalaemia, sodium depletion, normo-hypotension, reduced peripheral resistance, hyporesponsiveness to pressor agents, and activation of the renin-angiotensin-aldosterone system with increased plasma levels of Ang II [1]. Before the identification of the genetic defects, the increased production of vasodilatory prostaglandins present in BS/GS patients [2] was considered to play a pathogenetic role in the BS/GS’s characteristic electrolyte abnormalities, hyporesponsiveness to pressor agents and normo-hypotension. This formed the basis for the use of prostaglandin synthase inhibitors as one of the therapeutic options. The identification of the genetic defects of BS/GS clarified the pathogenesis of these diseases and established the hyporesponsiveness to pressor agents and normo-hypotension as secondary to mutations in cotransporters and ion channels determining Na and K wasting, while increased production of vasodilatory prostanoids as secondary to the consequent volume contraction and contributing to Na and K excretion. Na and K wasting and volume contraction are, in fact, the major consequences of BS/GS genetic abnormalities [1]. On the other hand, a series of papers from our laboratory [1,3] have demonstrated that, in addition to genetic abnormalities, an anomalous Ang II signal transduction system present in the cells of BS/GS patients plays an important role in the hyporesponsiveness of pressor agents, vascular tone regulation and normo-hypotension of these patients. This abnormal Ang II signalling has, in fact, been shown to lead to reduced intracellular inositol trisphosphate (IP3) and Ca++ release, reduced protein kinase C (PKC) activity, increased nitric oxide (NO) production, finally determining reduced vascular smooth muscle contraction [1,3]. Unfortunately, the clarification of the pathogenesis of BS/GS and the identification of important factors involved in the regulation of BS/GS patients’ vascular tone did not turn into advancements in new strategies for the therapeutic management of these diseases which has remained the same, based essentially on K supplements and prostaglandin synthase inhibitors, which have the objective to correct symptoms (Na and K wasting and volume depletion) more than the cause of the disease (mutations of cotransporters and ion channels), which is, at the moment, not therapeutically challenged.

Given the abnormal Ang II signalling and vascular tone regulation, together with the characteristic clinical picture, BS/GS is considered a good model to gain insight into the pathophysiological mechanisms involved in vascular tone regulation, hypertension and its long-term complications such as remodelling and atherosclerosis.

Ang II has, in fact, pleiotropic cellular effects mediated by the activation of short- and long-term signalling mechanisms [3,4]. The former involve monomeric and heterotrimeric G proteins, phospholipase C (PLC) ß and {gamma} and PLD, leading to most of the well known haemodynamic and endocrine effects of Ang II including vascular smooth muscle contraction (Figure 1, right). This pathway involves release of intracellular messengers such as IP3 and Ca++, activation of PKC, finally leading to vascular smooth muscle contraction. This pathway is known to be counterbalanced by the vasodilatory and antiproliferative activity of NO system; in fact, the activity of the endothelial subunit of NO synthase (ecNOS) is known to be negatively regulated by PKC. On the other hand, cellular effects mediated by long-term signalling of Ang II cause the cardiovascular remodelling, common to hypertension, atherosclerosis and heart failure, mostly through modulation of the cell oxidative state [4,5] (Figure 1, left). In fact, Ang II increases oxidative stress via upregulation of NADH/NADPH oxidase, the major superoxide (O2) generating enzyme, with consequent O2 overproduction [4,5]. Activation of p22phox, a 22-kDa {alpha} subunit of cytochrome b558 included in the NADH/NADPH oxidase, plays a key role in O2 production. It, in fact, functions as an integral subunit of the final electron transport from NADPH to haeme and molecular oxygen in generating O2, and is stimulated by Ang II [6]. This pathway also involves the induction of established oxidative stress-related effectors such as transforming growth factor ß (TGFß) [7] and PKC which activate oxidative stress-related kinases such as MAPK/ERK [8], finally leading to cardiovascular remodelling and atherogenesis. This pathway is counterbalanced by the activity of both NO and haeme oxygenase-1 (HO-1) systems, the latter known as being protective toward oxidative stress [9]. Its expression is also related to redox-independent stimuli [10], some of which, such as intracellular messenger cAMP and cGMP, lead also to vasodilation through the HO-1-induced production of the vasodilatory carbon monoxide (CO).



View larger version (24K):
[in this window]
[in a new window]
 
Fig. 1. Schematic representation of short and long-term Ang II signalling. Ang II short (right) and long (left) term signalling system, the former leading to the most well known haemodynamic and endocrine effects of the hormone, included vascular smooth muscle contraction, the latter causing remodelling in target organs essentially through induction of oxidative stress.

 
In BS/GS patients, the short-term signalling pathway of Ang II is blunted, as shown by reduced G{alpha}q gene expression, intracellular IP3 and Ca++ release and PKC activity [1,3]. However, little is known about the long-term signalling of Ang II mediated by the cell redox activation, as there is only indirect evidence of reduced oxidative stress. In fact, plasma from patients with BS/GS has less total volatile LDL oxidation products and less oxidizable LDL, despite the relatively small size and increased density of these lipoproteins [11,12].

Therefore, the aim of the present study was to investigate the Ang II-regulated redox state in BS/GS patients. To this end, we evaluated total antioxidant power (AOP) and peroxynitrite levels in plasma from patients with BS/GS, while we investigated the gene expression of oxidative stress-related proteins such as p22phox, and its C242T polymorphism as well as the gene expression of TGFß and HO-1 in circulating monocytes. In addition, the effect of Ang II stimulation on the gene expression of p22phox, TGFß and HO-1 was investigated in monocytes of BS/GS and control subjects.



   Subjects and methods
 Top
 Abstract
 Introduction
 Subjects and methods
 Results
 Discussion
 References
 
Patients
We studied a cohort of nine patients (six males and three females, 26–52 years old), with either BS (n = 2) or GS (n = 7), to these being the same patients evaluated in the previous reports [1,3]. BS/GS patients were both genetically and biochemically characterized as previously reported [3]. Ten healthy control subjects (six males and four females, age range 23–47 years) were recruited from the staff of the Department of Clinical and Experimental Medicine at Padova University. They had normal plasma and urinary electrolytes, plasma renin activity (PRA) and aldosterone levels. The clinical and biochemical characteristics of the patients are shown in Table 1.


View this table:
[in this window]
[in a new window]
 
Table 1. Clinical and laboratory data of the patients included in the study

 
None of the patients or controls was taking drugs at least for 2 weeks, and all the subjects abstained from food, alcohol and caffeine-containing drinks for at least 12 h, before the study.

Informed consent was obtained from all the study participants and the study protocol was approved by our institutional authorities.

Evaluation of PRA and plasma aldosterone
PRA and plasma aldosterone concentration were measured in the fasting condition and in the supine position for at least 1 h.

PRA was measured using an angiotensin I generation radioimmunoassay kit (RADIM, Angleur, Belgium) and plasma aldosterone with an aldosterone radioimmunoassay kit (Bouty Diagnostics, S.S. Giovanni, Italy). Normal values in patients on a diet containing 150–200 mmol of sodium per day are 0.2–2.8 ng/ml/h and 0.08–0.29 nmol/l, respectively.

Plasma electrolyte measurement
Plasma and urinary electrolytes were measured by a Kodak Ektachem 700 analyzer (Eastman Kodak Company, Rochester, NY, USA).

Plasma AOP
Total plasma AOP was evaluated with a commercially available kit (Med.Dia, Milan, Italy). It is assessed by evaluating Cu+ derived by reduction of a known amount of added Cu++. Cu+ is colorimetrically detected by the formation of a Cu+-Bathocuproine complex. This complex is stable and has a typical light absorption at 480–490 nm. The sensitivity of the assay is 22 µM. The results are compared with a standard curve obtained from samples of known concentration of uric acid, used as a typical reducent [13]. Intra-assay and inter-assay variations of the assay were 3 and 5%, respectively.

Plasma 3-nitrotyrosine
3-Nitrotyrosine, an estimate of the peroxynitrite plasma level, was evaluated by HPLC following the procedure described by Kaur and Halliwell [14], with minor modifications. Briefly, 2 ml of serum were analysed for nitrotyrosine after filtration through Centricon 10 filters (Amicon, Bedford, USA) at 3000 g/min for 1 h at 4°C. HPLC separation of 3-nitro-L-tyrosine was obtained with a 3µ C-18 column (150 x 4.6 mm) (Supelco, St Louis, USA), and a C-18 guard column (20 x 3.2 mm) (Sigma, St Louis, USA). The eluant was 0.5 mol/l KH2PO4–H3PO4 (pH 3.0), with 10% methanol (v/v) at a flow rate of 0.9 ml/min and an injecting volume of 50 µl. 3-Nitrotyrosine was detected by UV detector set at 274 and 220 nm. Using this procedure the lowest detection limit was 0.1 µmol/l. The identification of a 3-nitrotyrosine peak was confirmed by the addition of a 3-nitrotyrosine standard (Sigma) and by the ratio of absorbance at 220 and 274 nm in comparison with samples of the 3-nitrotyrosine standard. The coefficient of variation was 6.3 and 3.3% at concentrations of 2.0 and 10.0 µmol/l, respectively (n = 15). The mean recovery of 3-nitrotyrosine in tests of addition was 97% (n = 5). In all serum samples from healthy controls (n = 20), 3-nitrotyrosine levels were below the detection limit.

Molecular biology assays
Monocyte preparation. Peripheral blood monocytes (PBM), from 35 ml of EDTA anticoagulated blood were isolated by Ficoll Paque PPus gradient (Amersham Pharmacia Biotech, Uppsala, Sweden) and judged to be 85% pure and functionally alive by cytofluorometric analysis.

RNA extraction. RNA was extracted from PBM using a commercially available kit (RNA Ble, RNA Extraction, Eurobio, Les Ulis, France) with l ml of product per ~5 x 106 cells. The extracted RNA had an OD 280/260 ratio between 1.8 and 2.0.

Reverse transcription–polymerase chain reaction (RT–PCR). RT of RNA was performed with Gene Amp RNA PCR Kit, essentially as described by the manufacturer (Gene Amp RNA PCR Kit; Perkin Elmer, Foster City, USA). RNA (~1 µg) was reverse transcribed using random hexamer primers and MuLV reverse transcriptase in a Perkin Elmer 2400 thermalcycler (15 min at 42°C, 5 min at 99°C and 5 min at 5°C), as previously reported [4].

PCR. For p22phox mRNA expression, PCR was performed using specific primers designed with the aid of the Primer3 software as previously reported [3], and their sequence is: 5'–3': TGGGCGGCTGCTTGATGGT (nucleotide sequence positions 169–188) and GTTTGTGTGCCTGCTGGAGT (nucleotide sequence positions 465–485) encompassing the position of C242T polymorphism. The conditions of amplification were: 95°C for 1 min, 60°C for 1 min, 72°C for 1 min, for a total of 30 cycles of amplification.

The oligomer primers used for TGFß were: 5'–3': GCCCTGGACACCAACTATTGCT (nucleotide sequence positions 1678–1699) and AGGCTCCAAATGTAGG GGCAGG (nucleotide sequence positions 1817–1838). They were also designed using Primer3 software [3]. The conditions of amplification were: 94°C for 45 s, 60°C for 45 s, and 72°C for 2 min, for a total of 26 cycles of amplification.

The oligomer primers used for HO-1 gene expression were: 5'–3': CAGGCAGAGAATGCTGAGTTC (nucleotide sequence positions 79–99) and GCTTCACATAGCG CTGCA (nucleotide sequence positions 332–349). They were also designed using Primer3 software. The conditions of amplification were: 94°C for 30 s, 58°C for 1 min, 72°C for 1 min, for a total of 26 cycles of amplification.

The number of cycles used for the amplifications carried out in the present study was obtained from the analysis of a kinetic curve set for each gene using an increasing number of cycles from 20 to 40, in the order of 2, to determine the number of cycles corresponding to the exponential phase.

PCR products were separated by electrophoresis on polyacrylamide gel and silver stained.

The identity of PCR products was evaluated at Primm s.r.l. (San Raffaele Biomedical Science Park, Milan, Italy), using a PRISM Taq Polymerase Dye Terminator fluorescent sequencing kit (Perkin-Elmer, Foster City, USA) and analysed using an ABI 373 automated sequencer and ABI Prism analysis software. The sequence analysis was also used to check for the C242T polymorphysm of p22phox mRNA sequence whose topography in a potential haeme-binding site suggests a role in the regulation of oxidative stress [15].

ß-Actin PCR products, obtained by amplifying primers purchased from Eurobio (Les Ulis, France), were used as a control gene.

Evaluation of p22phox, TGFß and HO-1 gene expression. p22phox, TGFß, HO-1 and ß-actin gene expressions were quantified using a PCR-based densitometric semi-quantitative analysis using NIH image software, as previously reported [3]. The ratio between p22phox, TGFß and HO-1 and ß-actin PCR products (pixel density) were used as indexes of p22phox, TGFß and HO-1 gene expression.

Effect of Ang II on p22phox, TGFß and HO-1 gene expression. Monocytes from BS/GS patients as well as from controls were incubated in RPMI 1640 in the presence and absence of 100 nM Ang II for 1 h. This concentration was chosen since it was clearly seen to induce superoxide production through stimulation of NADH/NADPH oxidase [16]. Their RNA extraction, PCR analysis and quantitation of p22phox, TGFß and HO-1 were done as detailed above.

Statistical analysis
Data were evaluated on a Power Macintosh G4 computer (Apple Computer, Cupertino, CA, USA) using the Statview II statistical package (BrainPower Inc, Calabasas, CA, USA). Data were expressed as means ± SD and were analysed using the Mann–Whitney non-parametric test and Student’s t-test for paired and unpaired data. Values at a 5% level or less (P < 0.05) were considered significant.



   Results
 Top
 Abstract
 Introduction
 Subjects and methods
 Results
 Discussion
 References
 
Blood pressure, serum electrolytes, PRA and plasma aldosterone level of each patient and of the controls are reported in Table 1.

As expected, PRA (9.88 ± 4.64 vs 0.73 ± 0.13 ng Ang I/ml/h, P < 0.001) and plasma aldosterone (0.95 ± 0.08 vs 0.18 ± 0.02 nmol/l, P < 0.001) were higher in BS/GS subjects than in the control subjects.

Plasma AOP and peroxynitrite determination
Total plasma AOP was significantly higher in the patients than in the controls (3.27 ± 0.95 vs 1.05 ± 0.16 mmol/l, P = 0.002).

Peroxynitrite, a metabolic by-product of NO oxidation, evaluated as nitrotyrosine [14], was undetectable both in patients and controls (data not shown). This is not unexpected in control subjects with normal NO production but it is remarkable in the BS/GS patients, in whom a large NO production has already been reported [1,3].

p22phox, TGFß and HO-1 gene expression
Figure 2 shows representative experiments of PCR amplified p22phox, TGFß and HO-1 and their mean mRNA expression in monocytes from BS/GS patients and controls. Both p22phox and TGFß were reduced in BS/GS patients in comparison to controls [0.35 ± 0.08 vs 0.53 ± 0.05 densitometric units (d.u.), P = 0.005, for p22phox mRNA, and 0.82 ± 0.07 vs 1.15 ± 0.25 d.u., P = 0.006, for TGFß mRNA], while HO-1 mRNA level was increased [0.88 ± 0.07 vs 0.78 ± 0.11 d.u., P = 0.037].



View larger version (31K):
[in this window]
[in a new window]
 
Fig. 2. Densitometric analysis of p22phox (A), TGFß (B) and HO-1 (C) gene expression in monocytes of healthy controls (C) and of patients with BS/GS. The expression of p22phox, TGFß and HO-1 was assessed by reverse transcription polymerase chain reaction (RT–PCR), using specific primers, after the analysis of a kinetic curve set for each gene using an increasing number of cycles from 20 to 40, in the order of 2, to determine the number of cycles corresponding to the exponential phase, as reported in the Patients and methods, adjusted for the expression of the housekeeping gene ß-actin. *P = 0.005; P = 0.006; {diamondsuit}P = 0.037. The right side of each panel shows a polyacrylamide silver stained gel of p22phox and ß-actin PCR products of representative controls (C) and patients with BS/GS.

 
None of the patients had the C242T polymorphism of p22phox.

Effect of Ang II on p22phox, TGFß and HO-1 gene expression
Ang II exposure significantly increased p22phox, TGFß and HO-1 mRNA production only in controls, while co-incubation with Ang II induced no significant variation in p22phox, TGFß and HO-1 gene expression in BS/GS patients (Table 2 and Figure 3).


View this table:
[in this window]
[in a new window]
 
Table 2. Effect of Ang II (100 nM, 1 h) on p22phox, TGFß and HO-1 gene expression in monocytes from BS/ GS patients and controls, ex vivo

 


View larger version (54K):
[in this window]
[in a new window]
 
Fig. 3. Representative assay for p22phox (A), TGFß (B) and HO-1 (C) amplified oligonucleotides in monocytes from one GS patient (BS/GS) and from one control subject, at baseline (lanes 1 and 3, respectively) and after 1 h exposure to Ang II (100 nM) (lanes 2 and 4, respectively). The figure shows that Ang II significantly increases p22phox, TGFß and HO-1 gene expression only in the control subject. It can also be seen that at baseline p22phox (A) and TGFß (B) gene expression is lower in the patient (lane 1, A and B) compared to the control subject (lane 3, A and B), while HO-1 gene expression is higher in the patient (C). mwm, DNA molecular weight marker IX ({Phi}X174 Hae III).

 


   Discussion
 Top
 Abstract
 Introduction
 Subjects and methods
 Results
 Discussion
 References
 
Circulating blood cells are widely used in vascular biology to study ex vivo pathophysiological mechanisms of hypertension and remodelling [17]. In addition, the role of various inflammatory mechanisms such as mononuclear leucocyte infiltration for the development of hypertensive target organ damage has been increasingly recognized in the last few years [17]. Relevant to our study, a correlation between leucocyte (polymorphonuclear and mononuclear cells) intracellular oxidative stress and hypertension has recently been demonstrated [18]. Therefore, these types of cells are a useful tool to investigate processes involved in hypertension, oxidative stress and remodelling, so as to gather proof of a generalized phenomenon that could be extended to vascular smooth muscle or endothelial cells, both of which are involved in the regulation of vascular tone and remodelling, but are not as easily accessible as the circulating blood cells. In the present study, monocytes were also used to extend previous observations with the same cells which demonstrated abnormalities of Ang II signalling and vascular tone regulation in BS/GS patients [1,3].

Ang II activates short- and long-term signalling pathways in the vasculature, which ultimately lead to vasoconstriction, vascular remodelling and atherosclerosis. The former are mediated through the G protein–phospholipase C–PKC cascade (Figure 1, right), the latter through production of reactive oxygen species and activation of redox sensitive genes (Figure 1, left) [4,5].

In previous investigations of BS/GS patients, we showed an abnormal short-term cell signalling pathway for Ang II [1,3]. The present study extends the previous observations by showing that the gene expression of oxidative stress-related proteins (p22phox and TGFß) are also reduced in patients with BS/GS. In view of their regulation by Ang II, these data suggest a complex alteration of the intracellular Ang II signal transduction in BS/GS patients involving both short- and long-term signalling pathways.

One important tonic signal pathway of Ang II is the stimulation of the NADH/NADPH oxidase [3,6,16]. This enzyme transfers electrons from NADH or NADPH to molecular oxygen, producing O2 [6]. Ang II activation of this oxidase is delayed and sustained and this action is integral to the cell growth response to Ang II [46]. p22phox, a 22-kDa {alpha} subunit of cytochrome b558 included in the NADH/NADPH oxidase, is an integral subunit of the final electron transport from NADPH to haeme and molecular oxygen in generating O2 [6]. Upregulation of p22phox contributes to NADH/NADPH oxidase activation and the development of hypertension in high Ang II level conditions [6].

In our BS/GS patients, plasma Ang II concentration was not measured, but PRA and aldosterone levels were high, thus indicating high plasma Ang II concentrations. Increased Ang II and reduced p22phox gene expression suggest blunted sensitivity to Ang II of this transduction pathway, as was shown for the other Ang II-mediated pathway [1,3]. The blunted increase of p22phox, TGFß and HO-1 gene expression upon incubation with Ang II in vitro in BS/GS patients compared to controls, strengthens the evidence of a blunted response to Ang II in BS/GS patients. Furthermore, none of the patients had the C242T polymorphism of p22phox which is involved in the generation of ROS in the vascular wall and premature atherosclerosis [15].

The decline of TGFß, together with its reduced increase upon Ang II stimulation, is also consistent with a reduced oxidative stress-related response in BS/GS patients. TGFß is one of the effector signals of oxidative stress [7,19]. In vitro, oxidative stress enhances TGFß gene expression [7] and, in vivo, rats placed on antioxidant-deficient diets (i.e. free of selenium and/or vitamin E) demonstrate increased TGFß expression, renal hypertrophy, proteinuria, tubulointerstitial thickening and loss of glomerular filtration rate, associated with increased lipid peroxidation of the renal membranes [7]. The increase of TGFß, a major pro-fibrotic cytokine [20], could accelerate the progression of renal disease.

Finally, the contention that oxidative stress could be reduced in BS/GS patients is strengthened further by the demonstration of increased HO-1 gene expression. In fact, HO is a rate-limiting enzyme that catalyses the degradation of haeme into biliverdin and CO [9]. Biliverdin is further metabolized to bilirubin, which is a very potent antioxidant [9].

NO is a free radical that has been shown to stimulate HO activity. The incubation of endothelial cells with SNP, a NO donor, thus, increases HO activity [21]. In our study, therefore, the increased gene expression of HO-1 could be linked to the increase in NO production present in BS/GS patients. The increased production of NO in these patients [1] would activate HO-1 gene expression, which is the predominant regulator of NOS activity in mononuclear cells [9]. On the other hand, HO-1 has also been linked to long-term anti-inflammatory and anti-proliferative effects [9,10] and it has been shown that HO-1 is also regulated by non-oxidant mediators [10], some of them, such as intracellular messengers cAMP and cGMP, lead to vasodilation also through HO-1-induced CO production [9,10]. Relevant to our findings, both cAMP and cGMP are increased in BS/GS [1]. Enhanced production of the vasodilator CO by HO-1 may contribute to the hypotension of BS/GS patients. It has also been found that TGFß downregulates HO-1 [22] and it is therefore reasonable to hypothesize that the reduction of TGFß seen in BS/GS patients may cooperate to increase HO-1 gene expression. Therefore, increased HO-1 may represent a powerful additive compensatory mechanism towards an oxidative stress-related response in BS/GS patients.

The increased plasma AOP is also in keeping with a low oxidative stress-related response in BS/GS patients and it may result from a variety of factors. One potential contributor is HO-1-mediated production of the antioxidant bilirubin. In addition, it could reflect sparing of other scavengers as a consequence of decreased reactive oxygen species production. This is supported by the finding of a low plasma level of peroxynitrite, a NO oxidized derivative of the chemical reaction with O2, which was undetectable in plasma of BS/GS patients as in the control plasma despite increased NO production in the former [1].

In conclusion, the information obtained from the results of this study, derived from the contemporary evaluation in our patients of gene expression of three different oxidative stress-related proteins, together with the evaluation of other oxidative stress-related markers, such as AOP and peroxynitrite plasma levels, are suggestive of a reduced redox state in BS/GS patients. However, further studies at the protein level are needed to confirm the existence of a reduced redox state in BS/GS patients.

Oxidative stress is a major damaging factor in a variety of diseases [23]. Understanding how the body responds to and defends itself against oxidative stress represents an area of major interest. A recent review by Dzau [5] detailed the relationships between Ang II, oxidative stress, reduced NO availability, hypertension and vascular remodelling. The results of the present study, in combination with our earlier results [1,3], suggest that BS/GS patients represent the mirror image of the one proposed by Dzau [5] for patients with hypertension and atherosclerosis. In fact, a possible scenario of short- and long-term signalling of Ang II in BS/GS patients is shown in Figure 4. Reduced gene expression of an {alpha} subunit of Gq protein reduces phospholipase Cß (PLCß) activity leading to reduced IP3 and diacylglycerol (DAG) production. The former leads to reduced intracellular Ca++ release, whereas the latter leads to reduced PKC activity. This is followed by a decrease in phosphorylation of myosin light chain kinase finally leading to reduced vascular smooth muscle contraction, reduced vascular tone regulation and normo-hypotension. Reduced activity of PKC also upregulates gene expression of ecNOS [3], to which corresponds an upregulation of HO-1 with a consequent increase in the production of their vasodilatory products NO and CO, which also contribute to reduced vascular tone in BS/GS patients.



View larger version (26K):
[in this window]
[in a new window]
 
Fig. 4. Possible scenario of short- and long-term Ang II signalling in BS/GS as depicted by the results of our previous and present studies [1,3]. Reduced gene expression of {alpha} subunit of Gq protein reduces phospholipase Cß (PLCß) activity leading to reduced IP3 and DAG production. The first leads to reduced intracellular Ca++ release, the latter to reduced activity of PKC, reduced vascular smooth muscle contraction, reduced vascular tone regulation and normo-hypotension. Reduced activity of PKC also upregulates gene expression of the ecNOS [3], with consequent upregulation of HO-1 and increased production of NO and CO both contributing to the reduced vascular tone of BS/GS. Reduced Ang II-mediated gene expression of the NAD(P)H subunit p22phox leads to reduced O2 production and the reduced expression of TGFß, the reduced activity of PKC, the increased expression of ecNOS and HO-1 and the increased production of NO and CO point toward an anomalous long-term signalling of Ang II leading to reduced fibrogenic activity and remodelling in BS/GS. Dashed lines, inhibitory action.

 
The Ang II-mediated induction of O2 production through stimulation of NAD(P)H oxidase should be reduced in BS/GS patients given the reduced gene expression of NAD(P)H subunit p22phox. Reduced expression of other oxidative stress-related proteins such as the fibrogenic cytokine TGFß, reduced activity of PKC, increased expression of ecNOS and HO-1 and increased production of NO and CO all point toward an abnormal long-term signalling of Ang II leading to reduced fibrogenic activity and remodelling in BS/GS patients.

The homeostatic interplay between the Ang II and the NO systems is also highlighted in such patients. It may contribute to understand how a defect of this interplay can lead to pathological conditions, such as hypertension and vascular remodelling on the one hand, and to the vascular hyporeactivity and hypotension typical of BS/GS patients on the other. Our ongoing studies of vascular reactivity in BS/GS patients provide a more detailed insight into the mechanisms of the pathways responsible for the regulation of the redox state, as well as vascular tone and remodelling. Experimental findings in patients with these syndromes point to defects in Ang II signalling through abnormalities of G protein or other components (MAPK, ERK, etc.) [1,3,8] as being central for the control of both redox state and vascular reactivity.



   Acknowledgments
 
This study has been supported in part by a 60% grant from MURST to A. Semplicini. The authors are sincerely grateful to the non-profit Association for Scientific Research in Nephrology (ARSN, Padova, Italy) and its President, Professor Augusto Corsini, MD, Chief of the Second General Surgery Division at Padova University Hospital, for their support.



   References
 Top
 Abstract
 Introduction
 Subjects and methods
 Results
 Discussion
 References
 

  1. Calò L, Davis PA, Semplicini A. Regulation of vascular tone in Bartter’s and Gitelman’s syndromes. Crit Rev Clin Lab Sci 2000; 37: 503–523[CrossRef][Web of Science][Medline]
  2. Calò L, Cantaro S, Piccoli A, Favaro S, Bonfante L, Borsatti A. Full pattern of urinary prostaglandins in Bartter’s syndrome. Nephron 1990; 56: 451–452[CrossRef][Web of Science][Medline]
  3. Calò L, Ceolotto G, Milani M et al. Abnormalities of Gq mediated cell signaling in Bartter’s and Gitelman’s syndromes. Kidney Int 2001; 60: 882–889[CrossRef][Web of Science][Medline]
  4. Griendling KK, Ushio-Fukai M, Lassegue B, Alexander RW. Angiotensin II signaling in vascular smooth muscle. New concepts. Hypertension 1997; 29 [part 2]: 366–373[Abstract/Free Full Text]
  5. Dzau VJ. Tissue angiotensin and pathobiology of vascular disease. A unifying hypothesis. Hypertension 2001; 37: 1047–1052[Abstract/Free Full Text]
  6. Griendling KK, Soresen D, Ushio-Fukai M. NAD(P)H oxidase. Role in cardiovascular biology and disease. Circ Res 2000; 86: 494–501[Abstract/Free Full Text]
  7. Nath KA, Grande J, Croatt A, Haugen J, Kim Y, Rosenberg ME. Redox regulation of renal DNA synthesis, transforming growth factor-beta-1 and collagen gene expression. Kidney Int 1998; 53: 367–381[CrossRef][Web of Science][Medline]
  8. Abe J, Berk BC. Reactive oxygen species as mediators of signal transduction in cardiovascular disease. Trends Cardiovasc Med 1998; 8: 59–64[CrossRef][Web of Science]
  9. Maines MD. The heme oxygenase system: a regulator of second messenger gases. Annu Rev Pharmacol Toxicol 1997; 37: 517–554[CrossRef][Web of Science][Medline]
  10. Immenschuh S, Ramadori G. Gene regulation of heme oxygenase-1 as a therapeutic target. Biochem Pharmacol 2000; 60: 1121–1128[CrossRef][Web of Science][Medline]
  11. Calò L, Sartore G, Bassi A et al. Reduced susceptibility of low density lipoprotein to oxidation in patients with overproduction of nitric oxide (Bartter’s and Gitelman’s syndrome). J Hypertens 1998; 16: 1001–1008[CrossRef][Web of Science][Medline]
  12. Davis PA, Calò L. Is atherosclerosis a no NO state? Circulation 1999; 20: 2709–2712
  13. Bellomo G, Perrugini C, Bagnati M. Biochemical markers of lipoprotein oxidation. Clin Chem Lab Med 1998; 36: A41
  14. Kaur H, Halliwell B. Evidence for nitric oxide-mediated oxidative damage in chronic inflammation. Nitrotirosine in serum and synovial fluid from rheumatoid patients. FEBS Lett 1994; 350: 9–12[CrossRef][Web of Science][Medline]
  15. Cahilli C, Ballantyne CM, Lim DS, Gotto A, Marian AJ. A variant of p22phox, involved in the generation of reactive oxygen species in the vessel wall, is associated with progression of coronary atherosclerosis. Circ Res 2000; 86: 391–395[Abstract/Free Full Text]
  16. Zhang H, Schmeißer A, Garlichs CD et al. Angiotensin II-induced superoxide anion generation in human vascular endothelial cells: role of membrane-bound NADH/NADPH oxidases. Cardiovasc Res 1999; 215–222.
  17. Hilgers KF. Monocytes/macrophages in hypertension. J Hypertens 2002; 20: 593–596[CrossRef][Web of Science][Medline]
  18. Yasunari K, Maeda K, Nakamura M, Yoshikawa J. Oxidative stress in leukocytes is a possible link between blood pressure, blood glucose, and C-reacting protein. Hypertension 2002; 39: 777–780[Abstract/Free Full Text]
  19. Silacci P, Hayoz D. Oxidative stress as the triggering event for vascular remodelling. Nephrol Dial Transplant 1998; 13: 1343–1346[Web of Science][Medline]
  20. Basile DP. The transforming growth factor ß system in kidney disease and repair: recent progress and future directions. Curr Opin Nephrol Hypertens 1999; 8: 21–30[CrossRef][Web of Science][Medline]
  21. Motterlini R, Foresti R, Intaglietta M, Winslow RM. NO mediated activation of heme oxygenase: endogenous cytoprotection against oxidative stress to endothelium. Am J Physiol 1996; 270: H107–H114
  22. Hill-Kapturczak N, Truong L, Thamilselvan V, Visner GA, Nick HS, Agarwal A. Smad7-dependent regulation of heme oxygenase-1 by transforming growth factor-ß in human renal epithelial cells. J Biol Chem 2000; 275: 40904–40909[Abstract/Free Full Text]
  23. Dhalla NS, Temsha RM, Netticadan T. Role of oxidative stress in cardiovascular diseases. J Hypertens 2000; 18: 655–673[CrossRef][Web of Science][Medline]
Received for publication: 25. 9.02
Accepted in revised form: 21. 2.03


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Nephrol Dial TransplantHome page
L. A. Calo, M. Puato, S. Schiavo, M. Zanardo, C. Tirrito, E. Pagnin, G. Balbi, P. A. Davis, P. Palatini, and P. Pauletto
Absence of vascular remodelling in a high angiotensin-II state (Bartter's and Gitelman's syndromes): implications for angiotensin II signalling pathways
Nephrol. Dial. Transplant., September 1, 2008; 23(9): 2804 - 2809.
[Abstract] [Full Text] [PDF]


Home page
Nephrol Dial TransplantHome page
L. A Calo, A. Naso, G. Carraro, M. L. Wratten, E. Pagnin, L. Bertipaglia, M. Rebeschini, P. A Davis, A. Piccoli, and C. Cascone
Effect of haemodiafiltration with online regeneration of ultrafiltrate on oxidative stress in dialysis patients
Nephrol. Dial. Transplant., May 1, 2007; 22(5): 1413 - 1419.
[Abstract] [Full Text] [PDF]


Home page
Nephrol Dial TransplantHome page
E. Wieczorek-Surdacka, A. Surdacki, S. M. Bode-Boger, B. Schubert, and W. Sulowicz
Elevated plasma asymmetric dimethyl-L-arginine in a patient with Gordon syndrome
Nephrol. Dial. Transplant., January 1, 2007; 22(1): 268 - 271.
[Full Text] [PDF]


Home page
Nephrol Dial TransplantHome page
E. Pagnin, P. A. Davis, A. Semplicini, and L. A. Calo
The search for a link between inflammation and hypertension--contribution from Bartter's/Gitelman's syndromes
Nephrol. Dial. Transplant., August 1, 2006; 21(8): 2340 - 2342.
[Full Text] [PDF]


Home page
Nephrol Dial TransplantHome page
L. A. Calo, E. Pagnin, M. Mussap, P. A. Davis, and A. Semplicini
Rho/Rho-kinase and C-reactive protein relationship in hypertension and atherosclerosis
Nephrol. Dial. Transplant., April 1, 2006; 21(4): 1131 - 1132.
[Full Text] [PDF]


Home page
Diabetes CareHome page
P. A. Davis, E. Pagnin, A. Semplicini, A. Avogaro, and L. A. Calo
Insulin Signaling, Glucose Metabolism, and the Angiotensin II Signaling System: Studies in Bartter's/Gitelman's syndromes
Diabetes Care, February 1, 2006; 29(2): 469 - 471.
[Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
L. A. Calo, E. Pagnin, P. A. Davis, M. Sartori, A. Semplicini, A. C. Pessina, S. Wolfrum, Y. Rikitake, J. K. Liao, A. Dendorfer, et al.
Rho Kinase Inhibition and Vascular Protection: Support From Studies in Bartter and Gitelman Syndrome
Arterioscler. Thromb. Vasc. Biol., April 1, 2005; 25(4): e34 - e35.
[Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
E. Pagnin, G. Fadini, R. de Toni, A. Tiengo, L. Calo, and A. Avogaro
Diabetes Induces p66shc Gene Expression in Human Peripheral Blood Mononuclear Cells: Relationship to Oxidative Stress
J. Clin. Endocrinol. Metab., February 1, 2005; 90(2): 1130 - 1136.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (21)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Calò, L. A.
Right arrow Articles by Semplicini, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Calò, L. A.
Right arrow Articles by Semplicini, A.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?