Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (8)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Landau, D.
Right arrow Articles by Segev, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Landau, D.
Right arrow Articles by Segev, Y.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Nephrol Dial Transplant (2003) 18: 694-702
© 2003 European Renal Association-European Dialysis and Transplant Association

The effect of growth hormone on the development of diabetic kidney disease in rats

Daniel Landau1,, Eytan Israel1, Inessa Rivkis2, Leonid Kachko3, Bieke F. Schrijvers4, Allan Flyvbjerg4, Moshe Phillip5 and Yael Segev2

1 Department of Pediatrics, 2 Department of Immunology and 3 Department of Pathology, Soroka University Medical Center, Ben Gurion University of the Negev, Beer Sheva, Israel, 4 Medical Department M, Medical Research Laboratory M, Institute of Experimental Clinical Research, Aarhus Kommunehospital, Aarhus C, Denmark and 5 Felsenstein Medical Research Center, Institute for Endocrinology and Diabetes, Schneider Children's Medical Center of Israel, Petach Tikva, Sackler School of Medicine, Tel Aviv University, Tel Aviv, Israel



   Abstract
 Top
 Abstract
 Introduction
 Subjects and methods
 Results
 Discussion
 References
 
Background. Nephropathy is the most severe complication of diabetes mellitus. We investigated the effect of exogenous growth hormone (GH) administration on renal function and matrix deposition in the streptozotocin (STZ) model of type I-diabetic rat.

Methods. Adult female STZ-diabetic rats (D), non-diabetic control rats injected with saline (C) and control and diabetic rats injected with bovine GH for 3 months (CGH and DGH, respectively) were used.

Results. The usual renal hypertrophy seen in D animals was more pronounced in the DGH group. Creatinine clearance increased only in the D rats, but not in the other groups, including DGH. Albuminuria was observed in the D animals but was significantly elevated in the DGH group. Glomeruli from DGH animals showed more extensive matrix accumulation (manifested as an increase in mesangial/glomerular area ratio). Renal extractable insulin-like growth factor (IGF-I) mRNA was decreased in the D and DGH groups, but renal IGF-I protein was not significantly increased. Renal IGF binding protein-1 was increased in the D groups and further increased in the DGH group, at both the mRNA and protein levels.

Conclusions. GH-treated diabetic rats had less hyperfiltration and more albuminuria, concomitant with more glomerular matrix deposition, when compared with regular diabetic animals. This was associated with a significant increase in renal IGFBP-1, and dissociated from IGF-I changes. Thus, in this model, GH exacerbates the course of diabetic kidney disease.

Keywords: diabetes insulin-dependent; insulin-like growth factor; insulin-like growth factor binding protein-1; somatotropin; steptozotocin



   Introduction
 Top
 Abstract
 Introduction
 Subjects and methods
 Results
 Discussion
 References
 
Diabetic nephropathy is one of the main causes of mortality in both insulin- and non-insulin-dependent diabetes mellitus. It is currently the leading cause of end-stage renal disease in the Western world, and the only cause whose incidence is growing [1]. An increase in kidney size is a very early change in diabetes, and it is followed by obstruction of the glomerular capillary lumen and loss of glomerular filtration and function. Clinical findings include microalbuminuria followed by proteinuria, hypertension and worsening renal function [2].

Several studies have shown that the growth hormone (GH)-insulin-like growth factor (IGF) system may play a significant role in diabetic kidney disease and in other nephropathies. Studies in animal models have shown that the rapid increase in kidney size caused by streptozotocin (STZ)-induced insulin-dependent diabetes is preceded by an increase in extractable renal IGF-I [3]. Albuminuria usually occurs within 1 month of the onset of diabetes. Both the renal hypertrophy and the albuminuria can be prevented by administration of long acting somatostatin analogues [4]. Kidney tissue expresses receptors not only for IGF-I but also for GH [5]. Thus, even though most of the biologic effects of GH are IGF-I mediated, GH may also act independently of IGF-I. We have reported previously an increase in serum GH levels in non-obese diabetic (NOD) [6], as well as STZ-treated mice [7]. The increase in circulating GH imitates the changes described in humans. Using the same models, we also observed a blunting effect by GH receptor antagonist on diabetic renal hypertrophy [8]. The molecular mechanisms that mediate these effects are still unknown.

The ability of the STZ-induced model of diabetic kidney disease to imitate human diabetic nephropathy is disturbed by the fact that even after a follow up of 6 months, there is no appearance of uraemia or worsening of the proteinuria. However, in contrast with human diabetes, GH secretion in STZ-diabetic rats is inhibited [9]. Therefore, in this model, late sclerotic changes in the rat glomerulus may fail to develop because of a relative lack of elevation in serum GH. This paucity of circulating GH may prevent the activation of processes in the glomerular and tubular cells that lead to glomerulosclerosis.

The purpose of the present study was to investigate the role of GH in the induction of the advanced sclerotic changes seen in diabetic nephropathy, using the rat STZ-diabetic model. Given the major involvement of the renal IGF system in diabetic nephropathy and the control of this system by GH, the influence of such exogenous GH administration on kidney IGF system gene expression was also examined.



   Subjects and methods
 Top
 Abstract
 Introduction
 Subjects and methods
 Results
 Discussion
 References
 
Study design
Adult female Wistar rats with initial body weights of 200 g were studied. Rats were housed three per cage in a room with a 12:12 h artificial light cycle. Temperature and humidity were kept in a controlled range. The animals had free access to standard chow and tap water throughout the experiment. Previous studies [11] have shown that this regimen can keep rats with STZ-induced diabetes insulinopenic, hyperglycaemic and alive for long periods of time without their becoming ketotic. The animals were divided into four groups: controls (C), injected with saline only; diabetic rats (D) given a single i.p. injection of STZ in a dose of 55 mg/kg; GH-treated diabetic rats (DGH) given bovine GH (bGH) (Monsanto, St Louis, MO), in a single daily s.c. dose of 10 mg/kg body weight; and GH-treated non-diabetic age-matched rats (CGH), given the same daily bGH dose as the DGH group (additional controls). Only animals with serum glucose levels >18 mmol/l and glucosuria without ketonuria were included in the study. bGH was started as soon as the diabetic state was determined (>24 h of glycosuria from the time of STZ injection) and was given daily for 3 months. Body weights were recorded monthly. Urine was tested for ketone bodies weekly. Prior to death, the animals were placed in individual metabolic cages for determination of 24-h urine volume, glucose, creatinine and albumin. Creatinine clearance was corrected for animal body weight. The animals were killed by the end of 3 months. Blood was collected at that stage for assessment of creatinine and IGF-I. Kidneys were rapidly removed. The left kidney was snap-frozen in liquid nitrogen and was used for protein and mRNA levels determination. The right kidney was perfused and fixed with alternating intra-aortic injections of PBS (0.02 M, pH 7.4) and 10% neutral-buffered formalin until blanching was achieved, for histopathologic assessment.

Histopathological assessment
A 2-mm thick, horizontally cut slice from the middle of the left kidney (containing the papilla) was embedded in Technovit. Sections of 4–5 µm thickness were cut on a rotation microtome and stained with periodic acid-Schiff (PAS) and haematoxylin–eosin. All glomeruli in the sections were analysed by standard pathological criteria. All tissues were coded and blindly evaluated for the following parameters. The index of mesangial expansion was determined by a quantitative estimate of the width of the mesangial zones in each glomerulus as a function of the total glomerular area. Digital images were acquired through a light microscope (Zeiss Axioplan 2, Germany) and a refrigerated camera (Spot, Diagnostic Instruments, Inc.), using a TINA V2.10G densitometry software (Raytest Isotopenmegerifte GmbH, Germany). Light intensity was fixed and the same contrast range was used for all measurements. Thirty glomeruli were analysed per slide and four randomly selected animals were chosen from each experimental group. Measurements were performed by one investigator (I.R.) and repeated twice. The intra-observer variability was 9%.

Immunohistochemistry
For immunohistochemistry studies, paraffin sections (4 mm) were deparaffinized in xylene, hydrated in gradual ethanol concentrations and reacted for 1 h at room temperature with a monoclonal antimouse collagen type IV antibody (Zymed, CA). This was followed by incubation with an appropriate biotinylated second antibody for 30 min and with biotin–avidin complex peroxidase for 30 min (Vectastain ABC kit, Vector, CA). The reaction was developed with 3,3'-diaminobenzidine (DAB) as a substrate. The intensity of the staining was evaluated under light microscopy in a semiquantitative way (+1 to +3) for the different glomerular areas.

Kidney IGF-I protein
Kidney protein extraction was performed as described previously [7]. Briefly, 80–100 mg of tissue was homogenized on ice in 1 M acetic acid (5 ml/g tissue) with an Ultra Turrax TD 25 and further disrupted with a Potter Elvehjelm homogenizer. With this procedure, all IGF binding proteins (IGFBPs) are removed from kidney tissue. After lyophilization, the samples were re-dissolved in phosphate buffer (pH 8.0) and kept at -80°C until the IGF-I assay was performed in diluted extracts. Kidney IGF-I levels were measured by radioimmunoassay (RIA) using a polyclonal rabbit antibody (Nichols Institute Diagnostics, San Capistrano, CA) and recombinant human IGF-I as standard (Amersham International). The tissue IGF-I concentrations were corrected for the contribution of entrapped serumIGF-I. Mono-iodinated IGF-I {[125I-(Tyr31)]IGF-I} was obtained from Novo-Nordisk A/S (Bag-Svaerd, Denmark). Intra- and inter-assay coefficients of variation were <5 and 10%, respectively, for both assays.

Western immunoblot analysis
Kidney tissue was homogenized on ice with a polytron (Kinetica, Littau, Switzerland) in lysis buffer (50 mM Tris, pH 7.4, 0.2% Triton X-100) containing 20 mM sodium pyrophosphate, 100 mM NaF, 4 mM EGTA, 4 mM Na3VO4, 2 mM PMSF, 0.25% aprotinin and 0.02 mg/ml leupeptine. Extracts were centrifuged for 20 min at 17 000 g at 4°C and the supernatants collected and frozen. For the detection of kidney IGFBP-1 homogenates were mixed with 5x sample buffer and boiled for 5 min, then 100 µg portions of sample protein were loaded in each gel lane and subjected to 10% SDS–polyacrylamide gel, and electroblotted into nitrocellulose membranes. Blots were blocked for 1 h in TBS buffer (10 mM Tris, pH 7.4, 138 mM NaCl) containing 5% non-fat dehydrated milk, followed by overnight incubation with polyclonal antibody against IGFBP-1 (Santa Cruz Biotechnology, CA) diluted in TBS containing 5% dry milk. After washing three times for 15 min in TBST (0.05% Tween-20, the blots were incubated with secondary anti-mouse antibody conjugated to horseradish peroxidase for 1 h at room temperature and then washed again three times. The antibody band was visualized by enhanced chemiluminiscense (ECL; Amersham, Life Sciences Inc.) and exposed to Kodak-BioMax film (Eastman Kodak, Rochester, NY). Protein expression was quantified densitometrically using Fluorchem software (Alpha-Innotech, CA).

mRNA studies
Total RNA was prepared from frozen tissues by the Tri-reagent method (Molecular Research Center, Cincinnati, OH) and quantified by absorbency at 260 nm. The integrity of the RNA was assessed by visual inspection of the ethidium bromide-stained 28S and 18S RNA bands after electrophoresis through 1.25%/2.2 M formaldehyde gels. For northern blot analysis, 30 µg of total RNA were electrophoresed on 1.3% agarose/2.2 M formaldehyde gels in 3-morpholinopropanesulfonic acid buffer. The RNA was then transferred onto MagnaGraph (MSI, Westboro, MA) nylon membranes and cross-linked to the membrane with a UV cross-linker (Hoefer Scientific Instruments, San Francisco, CA). The rat IGFBP-1 probe (a gift from Dr L. Mathews, University of Oregon, USA) was radiolabelled with [32P]dCTP 3000 Ci/mmol (Amersham, UK) by a random primed DNA labelling kit (Boehringer Mannheim, Germany).

RNA hybridization was performed in a hybridization oven (Micro-4, Hybaid Ltd, UK) at 65°C for 20 h using a hybridization solution [0.2 mM Na2HPO4 pH 7.2, 7% (v/v) SDS, 1% (w/v) BSA and 1 mM EDTA]. The washings were done in 0.4x SSC and 0.1% SDS at 65°C. Gels were exposed to Kodak X-Omat AR film (Eastern Kodak) at -70°C with two intensifying screens. The autoradiograms were quantified with a PhosphorImager (Imagequant, Molecular Dynamics, Sunnyvale, CA). Each experiment was repeated twice.

Evaluation of renal IGF-I mRNA was performed using the RT–PCR method. The RNA samples were converted to cDNA by adding to each sample of RNA (13 µl) 7 µl of reverse transcriptase reaction mixture, containing: 1 µl of Moloney murine leukemia virus-reverse transcriptase (MMLV-RT; 200 U/µl, Sigma, Rechovot, Israel), 0.5 µl DTT (0.1 M, Sigma), 0.5 µl RNase inhibitor (40 U/µl, Sigma), 1 µl of oligo-d(T) 12–18 primer (0.5 µg/µl, Life Technologies, BRL, Gaithesburg, MD) and 1 µl of dNTP (2.5 nmol/µl each nucleotide, Sigma). The reaction tube was incubated for 1 h at 37°C, then the volume of each sample was adjusted to 60 µl and the enzyme inactivated by incubation for 10 min at 65°C.

IGF-I and ß-actin cDNA were then amplified by PCR using specific primers. IGF-I sense: GGACCAGAGACCCTTTGCGGGG; IGF-I antisense: GGCTGCTTTTGTAGGCTTCAGTGG; ß-actin sense: GACGAGGCCCAGAGCAAGAG; ß-actin antisense: GGGCCGGACTCATCGTACTC. Five microlitres of reverse transcription product was added to 45 µl of PCR reaction mixture containing 32.75 µl of H2O, 2.5 µl of 5' primer (20 µM), 2.5 µl of 3' primer (20 µM), 2 µl of dNTP (2.5 nmol/µl each nucleotide, Sigma), 5 µl of 10x reaction buffer and 0.25 µl Taq DNA polymerase (Sigma). A negative control consisting of the reaction mixture without the cDNA was included in each run. PCR was run for 20–25 cycles with ß-actin primers under the following conditions: 90 s at 95°C, then five to 10 cycles of 45 s each at 95°C, 90 s at 60°C and 60 s at 72°C. The last 15 cycles were run under the same conditions but at 72°C. Incubation was prolonged by 5 s in each cycle. PCR with IGF-I primers was run with the same protocol, except that the annealing temperature was 65 instead of 60°C. Every experiment was amplified with at least two different number of cycles to ensure that amplification was at the exponential phase of PCR. We found that 25–30 cycles for IGF-I and 20–25 cycles for ß-actin were in this range. Under these conditions we also found a linear dose–response of the PCR product to increasing doses of cDNA. Fifteen microlitres of each sample containing amplified cDNA were loaded onto an agarose gel (2%) containing ethidium bromide (0.5 µg/ml). A DNA size marker was run on the same gel (100 bp ladder, Life Technologies, BRL). PCR products were quantified densitometrically using Fluorchem software (Alpha-Innotech, CA). To correct for differences in loading we corrected densitometric values of IGF-I cDNA with corresponding values of ß-actin cDNA and the IGF-I/ß-actin ratio was calculated.

Urinary albumin excretion
The urinary albumin concentration in urine samples from 24 h urine collections obtained prior to death was determined by RIA, using rat albumin antibody and standards. The urine samples were stored at -20°C until assayed. Rabbit anti-rat antibody RARa/Alb was purchased from Nordic Pharmaceuticals and Diagnostics (Tilburg, The Netherlands). For standard and iodination, globulin-free rat albumin was obtained from Sigma Chemical Co. (St Louis, MO). Urine creatinine values were assessed simultaneously (using standard laboratory methods) to calculate albumin/creatinine ratios (U [Alb/Creat]). Natural logarithmic values for (U [Alb/Creat]) were calculated for each animal, due to an abnormal distribution of albuminuria data.

Statistics
One-way analysis of variance was used to evaluate differences between groups for multiple comparisons. The Kruskal–Wallis modification for non-parametric data was used as a first step, and the Mann–Whitney test for differences between the groups was used subsequently. A P value of <0.05 was considered as significant. Means are given as ±SEM.



   Results
 Top
 Abstract
 Introduction
 Subjects and methods
 Results
 Discussion
 References
 
Body and kidney weight
The diabetic rats had a significant depression in weight gain. By the end of the 3-month study period, body weight had increased in the D group by only 9±4%, and in the DGH group by 18±4% (P<0.05) (Figure 1AGo). In comparison, body weight in the C and CGH groups increased by 40±5% and 53±6%, respectively. The Mann–Whitney test identified significant body weight difference (P<0.05) between: C vs CGH; C vs D, C vs DGH, CGH vs DGH. The ratio of kidney weight to body weight (KW/BW) was significantly elevated in both the DGH and D groups (160±6% and 200±19% of C; P<0.05 vs C by Mann–Whitney test), but not in the CGH group (93±2% of C; P=NS vs C but <0.05 vs DGH) (Figure 1BGo).



View larger version (16K):
[in this window]
[in a new window]
 
Fig. 1.  Body weight (BW) at death (A) (presented as the percentage of BW at the beginning of the experiment) and kidney weight to body weight (KW/BW) (B) (presented as the percentage of control animals). C, control rats; CGH, C rats treated with bGH; D, diabetic rats; DGH, D animals treated with bGH. Differences between groups are significant by the Kruskal–Wallis test.

 

Creatinine clearance and urine albumin excretion
Creatinine clearance was measured by 24 h urine collection using metabolic cages prior to death. Creatinine clearance increased non-significantly in the D group (139±14% of C, P<0.05 by Mann–Whitney test), and was unchanged in the other groups, including the DGH group (101±28% of C) (Figure 2AGo).



View larger version (16K):
[in this window]
[in a new window]
 
Fig. 2.  Creatinine clearance (expressed as percentage of C animals) (A) and the ratio of the natural logarithmic values of urine albumin to creatinine (µg/mg) (B). C, control rats; CGH, C rats treated with bGH; D, diabetic rats; DGH, D animals treated with bGH. The Ln U (Alb/Creat) values between groups are signicantly different by the Kruskal–Wallis test. n=6 animals per group.

 
Albuminuria was measured from the same urine collections. Twenty-four hour albumin excretion after 3 months of disease was 178±50, 4557±1198 and 2497±602 µg/day in the C, D and DGH groups, respectively. The ratio of the natural logarithmic values of urinary albumin to creatinine (µg/mg) in these samples increased in both diabetic groups compared with C but was further increased in the D and DGH groups (208±18% of C vs 184±14% of C; P<0.05 by Mann–Whitney test) (Figure 2BGo).

Histopathological assessment
Diabetic non-treated animals showed global proliferation of mesangial cells, with expansion of mesangial matrix, as well as thickening of capillary walls. The glomeruli of the DGH animals showed more extensive matrix expansion and thickening of capillary walls, in comparison with both controls (C) and diabetic-non-treated animals (D). No significant changes were seen in the CGH animals (Figure 3Go). These changes were generalized all along the examined slides. No extensive glomerulosclerosis or sclerotic nodule formation in glomeruli was seen, and there was no tubulointerstitial infiltration by inflammatory cells in any of the experimental groups. Mesangial-to-glomerular area ratio was significantly different between the groups (124±4% and 158±3% of C in D and DGH groups, respectively; P<0.05 when comparing D vs C, DGH vs C and D vs DGH by Mann–Whitney test) (Figure 3BGo). Immunohistochemistry for type IV collagen showed a more increased type IV collagen intensity in both D and DGH groups in comparison with non-diabetic animals (Figure 4Go). Semiquantitative analysis of the staining intensity showed no changes between the D and DGH groups.



View larger version (124K):
[in this window]
[in a new window]
 
Fig. 3.  (A) Glomerular representative changes in the experimental groups (PAS stain, x400 magnification). (A) Normal glomerulus in control animals. (B) CGH group: glomerulus with mild focal thickening of peripheral capillary walls. (C) Untreated diabetic animals: proliferation of mesangial cells, with expansion of mesangial matrix. Segmental thickening of capillary walls is also seen. (D) DGH group (diabetic animals treated with bGH): proliferation of mesangial cells and expansion of mesangial matrix is more accentuated in comparison with D. The capillary walls are also more prominently thickened. (B) Mesangial to glomerular area calculations (expressed as the percentage of non-diabetic control), based on the assessment of four animals in each experimental group and 30 glomerular tufts/animal. Differences between groups are significant by the Kruskal–Wallis test.

 


View larger version (145K):
[in this window]
[in a new window]
 
Fig. 4.  Immunohistochemistry for type IV collagen in controls (C), control animals treated with GH (CGH), diabetic non-treated animals (D) and diabetic animals treated with GH (DGH). x400 magnification.

 

Renal IGF-I and IGFBP-1
Steady-state renal IGF-I mRNA levels were decreased in both D and DGH groups (P<0.05 when comparing C and CGH vs D, C and CGH vs DGH by the Mann–Whitney test) (Figure 5Go). However, renal extractable IGF-I protein was not significantly changed between the experimental groups, after 3 months of diabetes (131±13% and 127±8% of C; P=NS) (Figure 5Go). Steady-state renal IGFBP1 mRNA levels were increased in the D and DGH groups, more pronouncedly DGH (265±35% and 586±216% of C; P<0.05 when comparing C vs D and C vs DGH using the Mann–Whitney test). Renal IGFBP1 mRNA levels were not significantly elevated in the CGH group (200±70% of C; P>0.1) (Figure 6Go). A similar pattern was observed for IGFBP-1 protein content, as assessed by western blot analysis (Figure 7Go), including a significant difference between D and DGH animals (151±6% and 214±14% of C, respectively; P<0.05 by Mann–Whitney test).



View larger version (19K):
[in this window]
[in a new window]
 
Fig. 5.  (A) Renal IGF-I protein (shown as percentage of C animals). C, control rats; CGH, C rats treated with bGH; D, diabetic rats; DGH, D animals treated with bGH. n=5 animals per group. Analysis of variance showed no significant differences between groups. (B) Representative ethidium bromide stain of renal IGF-I mRNA, using RT–PCR. Each two bands from the same experimental group are duplicates of the same animal. The lower panel shows the amplification of the ß-actin mRNA, using the same amount of initial total RNA. (C) Densitometric analysis of five separate RT–PCR reactions (representing five different animals per group). The renal IGF-I/ß-actin ratio is represented as the percentage of non-diabetic control. Analysis of variance (Kruskal–Wallis modification) showed a significant difference between the experimental groups.

 


View larger version (42K):
[in this window]
[in a new window]
 
Fig. 6.  (A) Northern blot analysis of kidney IGFBP-1 mRNA, using 30 µg total RNA, in the control (C), bGH treated C (CGH), untreated diabetic (D) and bGH treated diabetic (DGH) rats. The 1.6 kb bands corresponding to the IGFBP-1 transcript are shown in the upper lane. The ethidium bromide staining of the 28S ribosomal RNA of the samples appears in the lower lane. (B) A PhosphorImager-based quantification of kidney IGFBP1 mRNA levels, from the autoradiogram shown in the upper panel is shown in the lower panel. The data are expressed as the percentage of control. Analysis of variance (Kruskall–Wallis) showed a significant difference between the experimental groups.

 


View larger version (18K):
[in this window]
[in a new window]
 
Fig. 7.  (A) Western blot analysis of kidney IGFBP-1 content, using 100 µg tissue lysates, in the control (1), bGH treated C (2), untreated diabetic (3) and bGH treated diabetic (4) rats. Total lysates were separated by SDS–PAGE, followed by immunoblot analysis, using anti-IGFBP-1 antibody. The 38 kDa band corresponds to IGFBP-1. Shown is a blot, representative of five independent experiments. (B) A densitometry analysis summarizing the five independent experiments. Data are expressed as the percentage of non-diabetic controls. Analysis of variance (Kruskall–Wallis) showed a significant difference between the experimental groups.

 



   Discussion
 Top
 Abstract
 Introduction
 Subjects and methods
 Results
 Discussion
 References
 
Previous investigations have suggested a role for GH in the pathogenesis of experimental renal growth and scarring. Mice transgenic for the bovine GH gene have increased body weight and develop severe glomerulosclerosis, leading to uraemic death [11]. In this model, there is a proportionate increase in kidney weight and body size, but a disproportionate increase in glomerular volume. Hypophysectomy has been shown to protect diabetic patients from developing nephropathy [12], and a GH-deficient strain of dwarf rats is relatively protected from the tendency to develop glomerulosclerosis after subtotal nephrectomy [13] or diabetic related renal hypertrophy [14]. The finding that kidney tissue expresses receptors not only for IGF-I but also for GH [5] suggests that even though many of the biologic effects of GH are IGF-I mediated, there is a possibility of an IGF-I-independent action of GH. In human insulin-dependent diabetes mellitus, serum GH levels are increased, and inversely correlated with metabolic control [15]. This is in contrast with the STZ rat model, where serum GH levels are depressed [9]. In our study, exogenous GH administration to STZ rats worsened the renal changes, as measured by different markers: albuminuria was higher, creatinine clearance was not elevated and there was more matrix deposition (composed among others, by type IV collagen) on light microscopy. On the other hand, there was still no overt renal insufficiency in this experimental design. Creatinine clearance was increased in the diabetic animals (D) but not increased in the diabetic animals treated with bGH (DGH). The lack of hyperfiltration in the GH-treated diabetic rats after 3 months of GH treatment could be due to both a prevention of glomerular hyperfiltration by GH or acceleration in the progression of nephropathy. However, albuminuria was markedly increased in the DGH animals in comparison with D. The glomeruli of the DGH animals also had more extensive fibrotic elements. These changes at 3 months of diabetes are remarkable, as the rat model is known to be relatively resistant to the development of glomerulosclerosis [16].

Increased GH action on target tissues may be an important risk factor (independent of IGF-I) for the development of diabetic complications, such as nephropathy and retinopathy. We have shown previously that liver GH receptor and GH-binding protein (GHBP) mRNA levels, as well as liver membrane GH binding assays were deeply decreased in NOD diabetic mice [17]. However, renal GH binding to kidney tissue may be increased in diabetic rats [18]. In addition, renal GHBP is up regulated in a model of long-term diabetes [19], without a change in renal GHR mRNA levels. Given the increased circulating GH levels applied in this model as well as in human disease, an increased biological effect of GH on the kidney tissue (including sclerosis) is possible.

No significant increase in renal extractable IGF-I protein was seen in this study. Previous reports on short-term STZ diabetes models have described a transient increase in extractable IGF-I protein in association with a decrease in renal IGF-I mRNA levels [3]. In contrast, there is a persistent increase in IGFBP-1 mRNA and protein in both the STZ-injected rat [10] and the NOD mouse model [8], suggesting either an increased trapping of IGF-I from the circulation or independent effects of IGFBP-1 on the kidney. The lack of IGF-I protein accumulation in this experiment favours the second possibility of independent IGFBP-1 action. For example, in the IGFBP-1 transgenic mouse model, glomerulosclerosis develops, in spite of a dwarf phenotype, in association with low IGF-I bioavailability and high circulating GH levels [20].

GH therapy in this model did not improve somatic growth. This could have been due to the catabolic condition of these animals, given that they were not injected with exogenous insulin. However, it is also known that a GH resistance exists in the diabetic state, perhaps caused by a decrease in the expression of hepatic GH receptors [6], thereby decreasing circulating IGF-I, which is less available to the target tissues involved in somatic growth. Alternatively, this state of GH insensitivity could also exist in the peripheral tissues.

Renal hypertrophy and glomerulomegaly are early markers for the development of glomerulosclerosis. In our study, renal hypertrophy was accentuated in the DGH vs the D animals. The glomerular basement membrane becomes thickened in insulin-dependent diabetes, irrespective of disease duration [21]. Glomeruli show mesangial expansion, owing to the increased deposition of extracellular matrix, which is composed mainly of type IV collagen (mostly its {alpha}-2 fraction), laminin and fibronectin. The accumulation of extracellular matrix within the mesangial areas is the most common early finding in glomerular lesions progressing to end-stage renal disease [22]. Progressive tubulointerstitial fibrosis is also typical, particularly at the time when reduction of the glomerular filtration rate becomes apparent [23]. Histopathological examination of the kidney in the STZ model shows mesangial cell proliferation but not advanced deposition of extracellular matrix or sclerosis [24], both characteristic features of human diabetic nephropathy. In our model, the increased matrix deposition in the glomeruli in association with the relative decrease in GFR and increase in albuminuria indicate that GH accelerates the sclerotic process associated with diabetes. The exact pathways of these changes are not clearly understood. Contradictory results using a similar model were published previously by Nickels et al. [25]. In that study there was no significant difference in the severity of the histopathologic changes between the GH-treated and non-treated diabetic animals. Contrary to their findings, we did find evidence for more severe renal damage in GH-treated diabetic rats. We have used a higher dose (10 mg/kg, equivalent to ~2 mg/day for a 200 g animal) and also opted to use bGH, which has a better affinity to the GH receptor and does not bind to the prolactin receptor as other GH formulations do [26]. In comparison, the dose used by Nickels et al. was only 0.2 mg/day and ovine GH was used. This higher dosage may cause significant metabolic and haemodynamic changes, such as blood pressure alterations, which have not been measured in this study. This concern should be addressed in future experiments. However, even transgenic mice for GH do not develop systemic hypertension [27].

In summary, diabetic rats treated with GH had less hyperfiltration and more albuminuria, concomitant with more glomerular sclerosis when compared with placebo-treated diabetic controls. This was associated with a significant increase in renal IGFBP-1, and was dissociated from IGF-I changes. Thus, in this model, GH exacerbates the course of diabetic renal changes.



   Acknowledgments
 
We thank Dr M. Frieger, from the Department of Epidemiology, Faculty of Health Sciences, Ben Gurion University, for the statistical evaluation of data. We also thank Chen Chayat, for the excellent technical assistance. This study was partially funded by a grant from the American Physicians Fellowship for Medicine in Israel.



   Notes
 
Correspondence and offprint requests to: Daniel Landau, MD, Pediatric Nephrology, Department of Pediatrics, Soroka Medical Center, P.O. Box 151, Beer Sheva 84101, Israel. Email: ldaniel{at}bgumail.bgu.ac.il Back



   References
 Top
 Abstract
 Introduction
 Subjects and methods
 Results
 Discussion
 References
 

  1. US Renal Data System (USRDS) Annual Data Report. Atlas of end stage renal disease in the United States. National Institutes of Diabetes and Digestive and Kidney Diseases, Bethesda, MD, 2001
  2. Viberti GC. Early function and morphological changes in diabetic nephropathy. Clin Nephrol 1979; 12:47–53[ISI][Medline]
  3. Flyvbjerg A. Putative pathophysiological role of growth factors and cytokines in experimental diabetic kidney disease. Diabetologia 2000; 43:1205–1223[CrossRef][ISI][Medline]
  4. Landau D, Segev Y, Afargan M et al. A novel somatostatin analogue prevents the development of renal diabetic complications in the non-obese diabetic (NOD) mouse. Kidney Int 2001; 60:505–512[CrossRef][ISI][Medline]
  5. Chin E, Zhou J, Bondy C. Renal growth hormone gene expression: relationship to renal insulin-like growth factor system. Endocrinology 1992; 131:3061–3066[Abstract]
  6. Landau D, Segev Y, Eshet R, Flyvbjerg A, Phillip M. Changes in the growth hormone-IGF-I axis in nonobese diabetic mice. Int J Exp Diab Res 2000; 1:9–18
  7. Flyvbjerg A, Bennett WF, Rasch R, Kopchick JJ, Scarlett JA. Effect of a long acting growth hormone receptor antagonist (G120K-PEG) on renal enlargement, glomerular hypertrophy and urinary albumin excretion in experimental diabetes in mice. Diabetes 1999; 48:377–382[Abstract]
  8. Segev Y, Landau D, Rasch R, Rasch R, Flyvbjerg A, Phillip M. Growth hormone receptor antagonism prevents early renal changes in the non-obese diabetic (NOD) mouse. J Am Soc Nephrol 1999; 10:2374–2381[Abstract/Free Full Text]
  9. Tannenbaum GH. Growth hormone secretory dynamics in streptozotocin diabetes: evidence of a role for endogenous circulating somatostatin. Endocrinology 1981; 108:76–82[ISI][Medline]
  10. Landau D, Chin E, Bondy C et al. Expression of insulin-like growth factor binding proteins in the rat kidney: effects of long-term diabetes. Endocrinology 1995; 136:1835–1842[Abstract]
  11. Pesce CM, Striker LJ, Peten EP, Elliot S, Striker GE. Glomerulosclerosis at both early and late stages is associated with increased cell turnover in mice transgenic for growth hormone. Lab Invest 1991; 65:601–605[ISI][Medline]
  12. Lundbaek K, Christensen NJ, Jensen VA et al. Diabetes, diabetic angiopathy and growth hormone. Lancet 1970; 2:131–133[ISI][Medline]
  13. El Nahas AM, Bassett AH, Cope GH. Role of growth hormone in the development of experimental renal scarring. Kidney Int 1991; 40:29–34[ISI][Medline]
  14. Muchaneta-Kubara EC, Sayed-Ahmend N, Besbas N et al. Experimental diabetic renal growth: role of growth hormone and insulin-like growth factor-I. Nephrol Dial Transplant 1994; 9:1395–1401[Abstract/Free Full Text]
  15. Press M, Tamborlane WV, Sherwin RS. Importance of raised growth hormone levels in mediating the metabolic derangements of diabetes. N Engl J Med 1984; 310:810–815[Abstract]
  16. Feld LG, Cachero S, Ellis EN et al. Resistance to glomerular injury in the diabetic biobreeding rat. Exp Physiol 1995; 80:991–1000[Abstract]
  17. Landau D, Segev Y, Eshet R, Fyvbjerg A, Phillip M. Changes in the growth hormone-IGF-I axis in nonobese diabetic mice. Int J Exp Diab Res 2000; 1:9–18
  18. Marshall SM, Flyvbjerg A, Frystyk J, Korsgaard L, Ørskov H. Renal insulin-like growth factor I and GHR binding in experimental diabetes and after unilateral nephrectomy in the rat. Diabetologia 1991; 34:632–639[Medline]
  19. Landau D, Domené H, Flyvbjerg A et al. Differential expression of renal growth hormone receptor and its binding protein in experimental diabetes mellitus. Growth Hormone IGF Res 1988; 8:39–45[Medline]
  20. Doublier S, Seurin D, Fouqueray B et al. Glomerulosclerosis in mice transgenic for human insulin-like growth factor-binding protein-1. Kidney Int 2000; 57:2299–2307[CrossRef][ISI][Medline]
  21. Hayashi H, Karasawa R, Inn H et al. An electron microscopy study of glomeruli in Japanese patients with noninsulin dependent diabetes mellitus. Kidney Int 1992; 41:749–757[ISI][Medline]
  22. Laurie GW, Horikoshi S, Killen PD, Segui-Real B, Yamada Y. In situ hybridization reveals temporal and spatial changes in cellular expression of mRNA for a laminin receptor, laminin, and basement membrane (type IV) collagen in the development kidney. J Cell Biol 1989; 109:1351–1362[Abstract/Free Full Text]
  23. Lane PH, Steffes MW, Fioretto P, Mauer SM. Renal interstitial expansion in insulin dependent diabetes mellitus. Kidney Int 1993; 43:661–667[ISI][Medline]
  24. Weil R. III, Nozawa M, Koss M, Weber C, Reemtsma K, McIntosh R. The kidney in streptozotocin diabetic rats. Morphologic, ultrastructural, and functional studies. Arch Pathol Med 1976; 100:37–49
  25. Nickels DA, Sabnis SG, Antonovych TT, Poth M. Effect of chronic growth hormone administration on diabetic nephropathy in the rat. Ann Clin Lab Sci 1993; 23:462–468[Abstract]
  26. Mode A, Tollet P, Wells T et al. The human growth hormone (hGH) antagonist G120RhGH does not antagonize GH in the rat, but has paradoxical agonist activity, probably via the prolactin receptor. Endocrinology 1996; 137:447–454[Abstract]
  27. Peten EP, Striker LJ, Fogo A, Ichikawa I, Patel A, Striker GE. The molecular basis of increased glomerulosclerosis after blockade of the rennin angiotensin system in growth hormone transgenic mice. Mol Med 1994; 1:104–115[Medline]
Received for publication: 3.12.01
Accepted in revised form: 21.10.02


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J. Am. Soc. Nephrol.Home page
R. Rabkin, I. Awwad, Y. Chen, E. A. Ashley, D. Sun, S. Sood, W. Clusin, P. Heidenreich, G. Piecha, and M.-L. Gross
Low-Dose Growth Hormone is Cardioprotective in Uremia
J. Am. Soc. Nephrol., September 1, 2008; 19(9): 1774 - 1783.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
A. Tarasiuk and Y. Segev
Chronic upper airway resistive loading induces growth retardation via the GH/IGF-I axis in prepubescent rats
J Appl Physiol, March 1, 2007; 102(3): 913 - 918.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (8)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Landau, D.
Right arrow Articles by Segev, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Landau, D.
Right arrow Articles by Segev, Y.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?