Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (10)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Boucherot, A.
Right arrow Articles by Kunzelmann, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Boucherot, A.
Right arrow Articles by Kunzelmann, K.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Nephrol Dial Transplant (2002) 17: 978-984
© 2002 European Renal Association-European Dialysis and Transplant Association

Cloning and expression of the mouse glomerular podoplanin homologue gp38P

Anissa Boucherot1, Rainer Schreiber1, Hermann Pavenstädt2 and Karl Kunzelmann1,

1 Department of Physiology and Pharmacology, University of Queensland, St Lucia, Brisbane, Australia and 2 Department of Medicine, Division of Nephrology, Albert-Ludwig-University Freiburg, Freiburg, Germany



   Abstract
 Top
 Abstract
 Introduction
 Subjects and methods
 Results
 Discussion
 References
 
Background. Puromycin aminonucleoside nephrosis (PAN) is a rat model for human minimal change nephropathy. During PAN, severe proteinuria is induced that is paralleled by a reduced expression of a rat podocyte protein, named podoplanin. The protein probably plays a role in maintaining the unique shape of podocytes. Recently, attenuated amino acid transport has been observed in cultured mouse glomerular epithelial cells treated with puromycin aminonucleoside (PA). In the present study, gp38P, a protein homologous to rat podoplanin was cloned from mouse glomerular epithelial cells and was found to be down-regulated by PA. A role for gp38P in membrane transport in mouse podocytes has been suggested.

Methods. Based on homology to rat podoplanin, the protein gp38P was cloned from mouse glomerular epithelial cells by RT–PCR. Mouse glomerular epithelial cells, mouse cortical collecting duct cells, and Xenopus oocytes were treated with PA and the expression of gp38P was examined by RT–PCR and western blot analysis. Expression of gp38P in other mouse tissues was demonstrated by RT–PCR. The possible impact of gp38P on amino acid transport and folic acid uptake was examined in Xenopus oocytes.

Results. gp38P cloned from mouse glomerular epithelial cells showed strong homologies to rat podoplanin and gp38, a protein expressed in the thymus and other tissues. RT–PCR analysis demonstrated ubiquitous expression of gp38P in epithelial and non-epithelial tissues. Quantitative RT–PCR and western blot analysis indicated down-regulation of gp38P in PA-treated glomerular epithelial cells along with loss of cell shape and cell lysis, which was not observed in other cell types. When expressed in Xenopus oocytes, gp38P had no impact on folic acid uptake or transport activity of the amino acid co-transporters CAT1, EAAC1, and rBAT.

Conclusion. Cultured mouse glomerular epithelial cells express the podoplanin homologue gp38P, which is down-regulated by PAs. gp38P is ubiquitously expressed and is likely to control specifically the unique shape of podocytes.

Keywords: amino acid transport; cloning; gp38; gp38P; kidney; mouse; podocytes; podoplanin; puromycin aminonucleoside; Xenopus oocytes



   Introduction
 Top
 Abstract
 Introduction
 Subjects and methods
 Results
 Discussion
 References
 
Puromycin aminonucleoside nephrosis (PAN) is an experimental rat model of human minimal change nephropathy [1]. Both diseases are characterized by proteinuria and morphological changes causing extensive flattening of podocyte foot processes, probably by actin rearrangements [24]. In a previous study, the expression of membrane proteins in podocytes isolated from puromycin-treated rats was examined. Based on differential immunolabelling and expression in a cDNA library, an integral membrane glycoprotein of 43 kDa has been isolated and was named podoplanin, after its putative transforming effects on podocytes foot processes [5]. A high degree of sequence identity with other glycoproteins was found, such as T1{alpha}-antigen, a glycoprotein found in osteoblasts (E11, OTS-8) and a protein detected in mouse thymus epithelium [6]. Moreover, podoplanin is homologous to a cell-surface sialoglycoprotein in MDCK cells, which has the characteristics of an influenza C virus receptor [7]. Podoplanin was shown to be specifically down-regulated in PAN [5]. Because podoplanin is important for controlling the shape of podocytes, it has been suggested that down-regulation of podoplanin leads to transformation of the foot processes, disturbances in glomerular filtration, and heavy proteinuria [6].

Defects in amino acid transport in podocytes could also contribute to the changes in glomerular filtration and the proteinuria. In a recent study, amino acid transport in cultured mouse glomerular podocyte-like cells was characterized [8]. It was found that these podocytes express numerous types of transporters for cationic, anionic, and neutral amino acids. Interestingly, it was also found that podocyte injury by puromycin is associated with disturbed amino acid transport. However, it was unknown whether mouse podocytes express a podoplanin-like protein. Moreover, a mouse podoplanin has not yet been cloned. Because expression of podoplanin in podocytes was suppressed in rats treated with puromycin, we explored whether a protein similar to podoplanin is expressed in mouse glomerular podocyte-like cells. The present data indicate that in fact, a similar protein is expressed in mouse podocytes, which is down-regulated by puromycin.



   Subjects and methods
 Top
 Abstract
 Introduction
 Subjects and methods
 Results
 Discussion
 References
 
Cell culture
A conditionally immortalized mouse glomerular epithelial (podocyte) cell clone was used in the present study, harbouring a temperature-sensitive mutant of immortalizing SV-40 large T-antigen coupled with a promoter regulated by {gamma}-interferon [9]. Glomerular podocyte-like cells were maintained in RPMI 1640 medium (Life Technologies, Germany) supplemented with 10% FCS (Boehringer Mannheim, Mannheim, Germany), 100 U/ml penicillin and 100 µg/ml streptomycin (Life Technologies) in a humidified atmosphere with 5% CO2. To propagate podocytes, the culture medium was supplemented with 10 U/ml mouse recombinant {gamma}-interferon (Sigma, Deisenhofen, Germany) to enhance the expression of T-antigen, and cells were cultured at 33°C (permissive conditions). To induce differentiation, podocytes were cultured on type-I collagen (Biochrom, Berlin, Germany) at 37°C without {gamma}-interferon (non-permissive conditions) and in the presence of 1% FCS for 2–3 weeks. Cells were characterized immunologically and stained positive for the Wilms tumor antigen and synaptopodin, both characteristic markers for podocyte foot processes in vivo [9]. Cells between passage 15 and 25 were used for the present experiments.

M1 cells were grown in culture dishes in DMEM medium (Life Technologies, Australia) supplemented with 1% FBS (Life Technologies, Australia), 100 U/ml penicillin and 100 µg/ml streptomycin (Life Technologies), and 1 µmol/l dexamethasone in a humidified atmosphere with 5% CO2.

Cloning of the mouse gp38 homologue from podocytes
Based on sequence homology with the protein gp38 (mouse thymus, accession no. M96645) [10] a pair of oligonucleotides (5'–3') TCCAACGAGACCAAGATGTG (sense) and AGCTCTTTAGGGCGAGAACCT (antisense) was synthesized. RT–PCR was performed on total RNA (20 ng) isolated from glomerular epithelial cells grown to confluence for 6 days at 37°C (94°C, 1 min; 60°C, 1 min; 72°C, 1 min; 30 cycles). A 540 bp product was obtained encoding the full-length cDNA sequence. Sequencing of the cDNA revealed a protein with 97% identity to gp38 from mouse and 80% identity to podoplanin from rat. For expression studies in Xenopus oocytes the cDNA encoding gp38P was subcloned into oocyte expression vector pTLN, that used the Xenopus ß-globin untranslated regions to boost expression in oocytes (kindly provided by Dr T. J. Jentsch, Hamburg, Germany) [11].

RNA isolation and quantitative analysis
Total RNA was isolated from glomerular epithelial cells grown to confluence for 6 days at 37°C. Cells were incubated for 24 h with 100 µg/ml puromycin aminonucleoside (PA). Products of 540 bp were amplified at non-saturating conditions using the primers 5'-TCCAACGAGACCAAGATGTG-3' (sense) and 5'-AGCTCTTTAGGGCGAGAACCT-3' (antisense) and 26 cycles (94°C, 1 min; 60°C, 1 min; 72°C, 1 min) and were compared semi-quantitatively. A GAPDH–cDNA fragment was amplified in the same samples and served as an internal control. M1-cells were grown to confluence and treated for 24 h with 0, 100, or 200 µg/ml PA. Total RNA was isolated using NucleoSpin RNAII (Machery and Nagel, Düren, Germany). Total RNA (6 µg), random hexanucleotide primer (0.1 µg/µg), dNTP mix (10 mM), DTT (0.1 M), and 5x first-strand buffer and reverse transcriptase (Superscript Life Technologies) were used to synthesize first-strand cDNA in 40 µl reactions. For competitive RT–PCR a competitor was created by deletion of 130 bp (bp 162–291) of gp38P cDNA using restriction endonucleases BbsI and BclI. Filling-in reaction was performed with DNA polymerase I (Klenow Fragment, MBI Fermentas) and the plasmid was religated using T4 DNA ligase (MBI Fermentas). For competitive PCR reactions, master mixes contained sense 5'-TCCAACGAGACCAAGATGTG-3' and antisense 5'-CTTTAGGGCGAGAACCTTCC-3' primers for gp38P (536 bp, competitor 406 bp). First-strand (2 µl) cDNA of the different samples and different dilutions of the competitor (1 µl) were added. Cycle conditions were 2 min at 94°C, 25 cycles of 30 s at 94°C, 30 s at 58°C, 1 min at 72°C, with a final extension period of 10 min at 72°C. PCR products were run in a 2% agarose gel stained with ethidium bromide. Total RNA was isolated in liquid nitrogen from various mouse tissues and after homogenization, using the protocol described above. gp38P cDNA was amplified (540 bp) using the above described conditions.

Western blot analysis of gp38P
Yolk-free homogenates were prepared and protein was isolated from Xenopus ooyctes 3–5 days after injection of cRNA for gp38P or water, respectively. Mouse glomerular epithelial cells were lysed in sample buffer containing 10% SDS and 100 mmol/l DTT. Podocytes were incubated for 24 h with 0, 50, 100, or 200 µmol/l PA and equal amounts of protein (30 µg) isolated from the different samples were separated on a 12.5% SDS polyacrylamide gel and analysed by western blotting. Similarly, the protein of one oocyte was separated on a 12.5% SDS page and was probed with a rabbit antibody to rat podoplanin (1:1000; kindly provided by Prof. D. Kerjaschki, University of Vienna, Austria) after transfer to a nitrocellulose membrane. Proteins were detected using an ECL western blotting detection kit (secondary antibody 1:4000).

Generation of cRNA and double electrode voltage clamp measurements in Xenopus oocytes
cDNA of the cloned gp38 homologue was linearized by MluI and cRNA was in vitro transcribed using Sp6 RNA polymerase and a cap analogue (mCAP RNA capping kit, Stratagene). cDNAs for the cationic amino acid transporter CAT1, the glutamate transporter EAAC1 and the transporter for dibasic and neutral amino acids (rBAT) (kindly provided by Dr S. Waldegger, Biozentrum Hamburg, Hamburg, Germany) were linearized and transcribed using T7 RNA polymerase. Isolation and microinjection of oocytes have been described in a previous report [12]. In brief, oocytes were kept in ND96-buffer: NaCl 96 mmol/l, KCl 2 mmol/l, CaCl2 1.8 mmol/l, MgCl2 1 mmol/l, HEPES 5 mmol/l, Na-pyruvate 2.5 mmol/l, pH 7.55), supplemented with theophylline (0.5 mmol/l) and gentamycin (5 mg/l) at 18°C. Oocytes of identical batches were injected with cRNA of gp38P and the amino acid transporters (each 20 ng). Oocytes injected with 50 nl double-distilled water served as controls. Two to four days after injection, oocytes were impaled with two electrodes (Clark instruments) that had resistances of <1 M{Omega} when filled with 2.7 mol/l KCl. A flowing (2.7 mol/l) KCl electrode served as bath reference. The bath was continuously perfused at a rate of 5–10 ml/min. All experiments were conducted at room temperature (22°C). Membrane currents were measured at different clamp voltages and data were collected continuously on a computer hard disc at a sample frequency of 1000 Hz.

3H+-folic acid uptake
gp38P and water-injected oocytes were incubated in 1 ml ND96 buffer containing either 1 nmol/l or 1 µmol/l 3H+-folic acid (26 Ci/mmol; TRK212 Amersham, Australia) in the presence or absence of 10 nmol/l and 10 µmol/l non-radioactive folic acid. Oocytes were harvested after 30, 60, and 180 min and were lysed in 50 µl buffer containing 1% SDS. After adding 200 µl scintillation fluid (Amersham, Australia), radioactivity was counted in a microplate liquid scintillation counter (1450 Microbeta Trilux, Wallac, Australia).

Materials and statistical analysis
All used compounds were of highest available grade of purity. Dimethyl sulfoxide was from Merck (Darmstadt, Germany). PA and all used L-amino acids were obtained from Sigma (Deisenhofen, Germany) and Calbiochem (San Diego, CA, USA). The data are shown as mean values±standard error of the mean (SEM); n refers to the number of experiments. Paired t-test was used to compare mean values within one experimental series. A P value <0.05 was accepted to indicate statistical significance.



   Results
 Top
 Abstract
 Introduction
 Subjects and methods
 Results
 Discussion
 References
 
Cloning of podoplanin and gp38 homologous protein from mouse podocytes
Based on a homology cloning approach, a 540-bp product was obtained by RT–PCR, which comprised the full-length cDNA sequence encoding a short protein sequence of 172 amino acids. The isolated cDNA had a 97% identity to mouse gp38 and 80% identity to rat podoplanin [5,10]. The protein was named gp38P according to its homology to gp38 and the source (podocytes) it was cloned from (accession no. AJ297944). The protein sequence suggests one transmembrane domain and a short cytosolic C-terminus containing a cAMP-dependent phosphorylation site and a protein kinase C phosphorylation site (Figure 1Go). Expression of gp38P is not unique to podocytes, but was also detected by RT–PCR and subsequent sequencing in cultured mouse M1 cortical collecting duct cells (Figure 2CGo). Moreover, gp38P shows a wide tissue distribution in mouse with expression in a large number of different epithelial and non-epithelial tissues (Figure 3Go). Moreover, the expression of gp38P in mouse glomerular epithelial cells was verified by western blot analysis (Figure 2BGo), using an antibody that detects the homologous protein podoplanin in rat podocytes [6]. Using this antibody, a 38-kDa protein band was labelled in lysates from Xenopus oocytes, suggesting expression of a similar protein in oocytes of Xenopus laevis (Figure 4AGo).



View larger version (24K):
[in this window]
[in a new window]
 
Fig. 1.  Cloning of mouse gp38P. Alignment of amino acid sequence of gp38P with mouse thymus gp38 (gp38, 172 amino acid) and rat podoplanin (podoplanin, 166 amino acid). The open reading frame contains a single transmembrane domain (TM) indicated by a solid line. The short cytosolic C-terminus contains a cAMP-dependent phosphorylation site (underlined amino acids) and a protein kinase C phosphorylation site (bold letters). Only differences in the amino acids sequence of gp38 and podoplanin are indicated by letters. Amino acids identical to gp38P are represented by bars. Gaps in the amino acid sequence are indicated by dots.

 


View larger version (56K):
[in this window]
[in a new window]
 
Fig. 2.  Effects of PA treatment on gp38P expression. (A) RT–PCR analysis of gp38P and GAPDH expression in cultured mouse podocytes. Cells were cultured in the absence (-PA) or presence (+PA) of PA (100 µg/ml) for 24 h. +/- indicates presence or absence of reverse transcriptase, M indicates marker. Note the reduced expression of gp38P after PA treatment. (B) Western blot analysis of gp38P in mouse podocytes exposed to 50 and 100 µg/ml PA, respectively, and in control cells. (C) RT–PCR analysis of gp38P expression in cultured mouse M1 collecting duct cells. Cells were cultured in the presence of 0, 100, or 200 µg/ml PA. Gp38P was amplified using 25, 35, or 45 PCR cycles. (D) Quantitative competitive PCR of gp38P. Various concentrations of competitor cDNA were included into the PCR reaction. No differences were found between control cells and cells treated with 100 µg/ml PA.

 


View larger version (53K):
[in this window]
[in a new window]
 
Fig. 3.  RT–PCR analysis of gp38P expression in epithelial and non-epithelial tissues isolated from mouse. + or –, presence or absence of reverse transcriptase respectively.

 


View larger version (30K):
[in this window]
[in a new window]
 
Fig. 4.  gp38P expression in Xenopus oocytes. Western blot analysis of gp38P expression in Xenopus oocytes. (A) Protein was isolated from Xenopus ooyctes 3–5 days after injection of gp38P–cRNA (lanes 1–5) or from water-injected oocytes. A 38-kDa band was detected in gp38P–cRNA and water-injected oocytes, suggesting expression of endogenous gp38P in Xenopus oocytes. (B) 3H+-folic acid uptake in Xenopus oocytes. gp38P (squares, +gp38P) and water (circles, –gp38P)-injected oocytes were incubated in ND96 buffer containing either 1 nmol/l (upper trace) or 1 µmol/l (lower trace) 3H+-folic acid. 3H+-folic acid uptake was determined in the presence (open circles and squares) or absence (filled circles and squares) of 10 nmol/l and 10 µmol/l non-radioactive folic acid.

 

Down-regulation of gp38P by treatment with puromycin
Next we examined whether gp38P is down-regulated in mouse glomerular podocyte-like cells by treatment with PA for 24 h (100 µg/ml). The same treatment has been shown to down-regulate the expression of podoplanin in rat podocytes in a previous study [5]. Expression of gp38P was assessed by RT–PCR using GAPDH as an internal control. All experiments were performed at least in triplets. As shown in Figure 2AGo, the expression of gp38P appeared reduced after incubation with PA whereas the expression of GAPDH was not changed due to PA treatment. Down-regulation of gp38P in mouse podocytes was confirmed by western blot analysis; 24-h incubation in 50 µg/ml PA reduced the expression of gp38P and incubation in 100 µg/ml PA completely abolished the expression (Figure 2BGo). Incubation at 100 µg/ml also induced deformation of mouse podocytes and a concentration of 200 µg/ml led to a complete lysis of the cells after 24 h. Thus, PA seems to down-regulate the expression of gp38P in mouse glomerular podocyte-like cells similar to the inhibition of expression of podoplanin in rat podocytes.

Similar to mouse glomerular podocyte-like cells, mouse M1 collecting duct cells were exposed to different concentrations of PA and the effects on the expression of gp38P were examined by RT–PCR. As assessed by different cycle numbers, amplification of gp38P–cDNA was unchanged by 24-h incubation with either 100 or 200 µg/ml PA (Figure 2CGo). Moreover, quantitative PCR using different amounts of an internal competitor did not reveal any differences in gp38P expression in PA-treated or non-treated cells (Figure 2DGo). Furthermore, and in contrast to mouse podocytes, PA treatment did not seem to exert any toxic effects on M1 cells. Similar, when Xenopus oocytes were incubated with various concentrations (0, 50, 100, 200 µg/ml) of PA for up to 14 days, no toxic effects could be detected (data not shown). Taken together, the results suggest that PA specifically down-regulates the expression of gp38P in podocytes, were it may play a role in maintaining proper cell shape.

Impact of gp38P on amino acid transport and folic acid uptake in Xenopus oocytes
According to western blot analysis shown in Figure 4AGo, water-injected Xenopus oocytes express a protein similar to gp38p. Thus, additional expression of exogenous gp38P could not be detected by western blot analysis (Figure 4Go, lanes 1–5). However, we tried to find out more about the putative function of gp38P by expressing the respective cRNA in Xenopus oocytes. We examined whether exogenous gp38P has any impact on folic acid binding and/or uptake, as similarly has been described previously for other 38-kDa glycoproteins [13]. gp38P-injected Xenopus oocytes were incubated for 30, 60, or 180 min in a ND96 buffer containing low (1 nmol/l) or high (1 µmol/l) concentrations of 3H+-folic acid. As shown in Figure 4BGo, the additional expression of gp38P (filled squares) had no impact on 3H+-folic acid uptake and was similar in water-injected oocytes (filled circles) at low or high concentrations of 3H+-folic acid. Uptake of 3H+-folic acid was competitively inhibited in the presence of a 10-fold concentration of unlabelled folic acid (open squares and circles).

Another previous report indicated a change in the amino acid transport in mouse podocytes after treatment with PA [8]. We therefore examined whether gp38P has an impact on amino acid transport in Xenopus oocytes upon solely expression or co-expression with the amino acid transporters rBAT, CAT1, or EAAC1. At a clamp voltage (Vc) of -100 mV, arginine (1 mmol/l; –gp38P, filled circles) and leucine (1 mmol/l) induced whole cell currents in rBAT expressing oocytes of 29.0±2.8 and 4.2±1.9 nA (n=5), respectively (Figure 5AGo and B). At Vc=+30 mV, arginine and leucine induced currents were 7.2±2.1 and 41.3±4.5 nA (n=5), respectively. Replacement of extracellular Na+ by NMDG+ had no impact. Thus, a typical Na+-independent transport of dibasic and neutral amino acids is induced by expression of rBAT [14]. A similar Na+-independent amino acid transport of 33.2±2.1 nA Na+ (n=6) was induced by arginine in oocytes expressing the cationic amino acid transporter CAT1 (Vc=–100 mV) (Figure 5CGo). A Na+-dependent glutamate transport of 88±17.2 nA (n=5) (Vc=-100 mV) was induced when the anionic amino acid transporter EAAC1 was expressed. The transport was reduced to 3.8±0.9 nA (n=4) in the absence of extracellular Na+. As shown for all three amino acid transporters, co-expression of gp38P (+gp38P, open circles) did not change the whole cell currents induced by any of these transporters, suggested that gp38P has no or only limited impact on the transport activity of amino acid transporters (Figure 5BGo–DGo).



View larger version (23K):
[in this window]
[in a new window]
 
Fig. 5.  Expression of the amino acid transporters rBAT, CAT1, and EAAC1 in Xenopus oocytes in the presence or absence of gp38P. (A) Whole cell current induced in a rBAT expressing oocyte by application of various concentrations of arginine to the extracellular bath solution. The oocyte was voltage clamped to -100 mV. (B) Changes in the whole cell currents induced in rBAT expressing oocytes by different concentrations of arginine in the extracellular bath solution. Impact of co-expression with gp38P (+gp38P). (C) Changes in the whole cell currents induced in CAT1 expressing oocytes by different concentrations of arginine in the extracellular bath solution. Impact of co-expression with gp38P (+gp38P). (D) Changes in the whole cell currents induced in EAAC1 expressing oocytes by different concentrations of glutamate in the extracellular bath solution. Impact of co-expression with gp38P (+gp38P).

 



   Discussion
 Top
 Abstract
 Introduction
 Subjects and methods
 Results
 Discussion
 References
 
Podocytes are highly specialized glomerular epithelial cells and have an important function in forming a barrier during glomerular filtration [15]. In the present paper we describe cloning of gp38P from mouse podocytes, a protein that shares a high degree of identity with podoplanin expressed in rat podocytes. The protein is widely expressed in mouse tissues and may even be present in Xenopus oocytes.

The expression of podoplanin in rat podocytes has been shown to be selectively down-regulated by PA. PAN is an established model for human minimal change nephropathy [4]. The present study indicates that the structurally similar protein gp38P present in mouse glomerular podocytes is also down-regulated by PAN. Interestingly, down-regulation by PA seems to be specific for podocytes and was not observed in another mouse kidney cell line, obtained from isolated collecting duct cells.

It has been described that mouse glomerular podocytes respond to PA treatment with attenuation of amino acid transport activity by about 70%, as detected in patch clamp experiments [8]. This indicates that altered amino acid transport in PA-injured podocytes is paralleled by a reduced expression of gp38p and suggests that gp38P is somehow involved in the control of amino acid transport. However, upon expression in Xenopus oocytes, gp38p did not induce amino acid transport and had no impact on the activity of other co-expressed amino acid transporters such as CAT1, EAAC-1, or rBAT. Moreover, other 38-kDa glycoproteins were found to have a function in folic acid transport [13,16]. According to the present results obtained in Xenopus oocytes, this does not seem to apply to gp38P. Although it is unlikely that gp38P controls amino acid or folic acid transport, the present experiments cannot completely excluded this possibility, as Xenopus oocytes seem to express a protein similar to gp38P.

It was suggested that podoplanin is a structural component of podocyte foot processes, essential for controlling the unique shape of podocytes and thus maintaining proper glomerular filtration [6]. PA treatment leads to reduced expression of podoplanin and to flattened podocytes. In our experiments, we also observed morphological changes of podocyte-like cells in culture along with a reduced expression of gp38P. Although gp38P is widely expressed, the effect of PA on gp38P seems to be specific for podocytes and was not observed in other cell types, similar to a previous report [6]. Thus, it is very likely that gp38P forms a structural protein, necessary to maintain proper cell shape in podocytes.



   Acknowledgments
 
We thank C. Hupfer for her excellent technical assistance. The cultured glomerular podocyte-like cells used in this study were a gift from Dr P. Mundel, New York, USA. The podoplanin antibody was a generous gift from Professor Kerjaschki, University of Vienna, Austria. The present study was supported by DFG Ku756/4-1, Cystic Fibrosis Australia and German Mukoviszidose e.v.



   Notes
 
Correspondence and offprint requests to: Karl Kunzelmann, Department of Physiology and Pharmacology, University of Queensland, St Lucia, QLD 4072, Brisbane, Australia. Email: kunzelmann{at}plpk.uq.edu.au Back



   References
 Top
 Abstract
 Introduction
 Subjects and methods
 Results
 Discussion
 References
 

  1. Vernier RL, Papermaster BW, Good RA. Aminonucleoside nephrosis. I. Electron microscopic study of the renal lesions in rat. J Exp Med1959; 109: 115–126[Abstract]
  2. Smoyer WE, Mundel P, Gupta A, Welsh MJ. Podocyte alpha-actinin induction precedes foot process effacement in experimental nephrotic syndrome. Am J Physiol1997; 273: F150–F157[Abstract/Free Full Text]
  3. Whiteside CI, Cameron R, Munk S, Levy J. Podocytic cytoskeletal disaggregation and basement-membrane detachment in puromycin aminonucleoside nephrosis. Am J Pathol1993; 142: 1641–1653[Abstract]
  4. Kerjaschki D. Dysfunctions of cell biological mechanisms of visceral epithelial cell (podocytes) in glomerular diseases. Kidney Int1994; 45: 300–313[Web of Science][Medline]
  5. Breiteneder-Geleff S, Matsui K, Soleiman A et al. Podoplanin, novel 43-kDa membrane protein of glomerular epithelial cells, is down-regulated in puromycin nephrosis. Am J Pathol1997; 151: 1141–1152[Abstract]
  6. Matsui K, Breitender-Geleff S, Soleiman A, Kowalski H, Kerjaschki D. Podoplanin, a novel 43-kDa membrane protein, controls the shape of podocytes. Nephrol Dial Transplant1999; 14 (Suppl 1): 9–11[Free Full Text]
  7. Zimmer G, Klenk HD, Herrler G. Identification of a 40-kDa cell surface sialoglycoprotein with the characteristics of a major influenza C virus receptor in a Madin–Darby canine kidney cell line. J Biol Chem1995; 270: 17815–17822[Abstract/Free Full Text]
  8. Gloy J, Reitinger S, Fischer K-G et al. Amino acid transport in mouse podocytes. Am J Physiol2000; 278: F999–F1005[Abstract/Free Full Text]
  9. Mundel P, Reiser J, Zuniga MB et al. Rearrangements of the cytoskeleton and cell contacts induce process formation during differentiation of conditionally immortalized mouse podocyte cell lines. Exp Cell Res1997; 236: 248–258[Web of Science][Medline]
  10. Farr AG, Berry ML, Kim A, Nelson AJ, Welch MP, Aruffo A. Characterization and cloning of a novel glycoprotein expressed by stromal cells in T-dependent areas of peripheral lymphoid tissues. J Exp Med1992; 176: 1477–1482[Abstract/Free Full Text]
  11. Lorenz C, Pusch M, Jentsch TJ. Heteromultimeric CLC chloride channels with novel properties. Proc Natl Acad Sci USA1996; 93: 13362–13366[Abstract/Free Full Text]
  12. Briel M, Greger R, Kunzelmann K. Cl- transport by CFTR contributes to the inhibition of epithelial Na+ channels in Xenopus ooyctes coexpressing CFTR and ENaC. J Physiol (Lond)1998; 508/3: 825–836[Abstract/Free Full Text]
  13. Weitman SD, Weinberg AG, Coney LR, Zurawski VR, Jennings DS, Kamen BA. Cellular localization of the folate receptor: potential role in drug toxicity and folate homeostasis. Cancer Res1992; 52: 6708–6711[Abstract/Free Full Text]
  14. Bertran J, Werner A, Moore ML et al. Expression cloning of a cDNA from rabbit kidney cortex that induces a single transport system for cystine and dibasic and neutral amino acids. Proc Natl Acad Sci USA1992; 89: 5601–5605[Abstract/Free Full Text]
  15. Pavenstadt H. Roles of the podocyte in glomerular function. Am J Physiol Renal Physiol2000; 278: F173–F179[Abstract/Free Full Text]
  16. Campbell IG, Jones TA, Foulkes WD, Trowsdale J. Folate-binding protein is a marker for ovarian cancer. Cancer Res1991; 51: 5329–5338[Abstract/Free Full Text]
Received for publication: 27. 3.01
Accepted in revised form: 5. 1.02


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Mol. Cell. Biol.Home page
K. Zhang, C. Barragan-Adjemian, L. Ye, S. Kotha, M. Dallas, Y. Lu, S. Zhao, M. Harris, S. E. Harris, J. Q. Feng, et al.
E11/gp38 Selective Expression in Osteocytes: Regulation by Mechanical Strain and Role in Dendrite Elongation
Mol. Cell. Biol., June 15, 2006; 26(12): 4539 - 4552.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Kato, N. Fujita, A. Kunita, S. Sato, M. Kaneko, M. Osawa, and T. Tsuruo
Molecular Identification of Aggrus/T1{alpha} as a Platelet Aggregation-inducing Factor Expressed in Colorectal Tumors
J. Biol. Chem., December 19, 2003; 278(51): 51599 - 51605.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
G. D. Han, H. Koike, T. Nakatsue, K. Suzuki, H. Yoneyama, S. Narumi, N. Kobayashi, P. Mundel, F. Shimizu, and H. Kawachi
IFN-Inducible Protein-10 Has a Differential Role in Podocyte during Thy 1.1 Glomerulonephritis
J. Am. Soc. Nephrol., December 1, 2003; 14(12): 3111 - 3126.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (10)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Boucherot, A.
Right arrow Articles by Kunzelmann, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Boucherot, A.
Right arrow Articles by Kunzelmann, K.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?