Nephrol Dial Transplant (2002) 17: 399-407
© 2002 European Renal Association-European Dialysis and Transplant Association
Administration of FR167653, a new anti-inflammatory compound, prevents renal ischaemia/reperfusion injury in mice
Department of Gastroenterology and Nephrology, and Division of Blood Purification, 1 Department of Molecular Oncology, Cancer Research Institute, Kanazawa University, and 2 Department of Molecular Preventive Medicine, Graduate School of Medicine, The University of Tokyo, Tokyo, Japan
| Abstract |
|---|
|
|
|---|
Background. Various types of chemokines/cytokines play important roles in ischaemia/reperfusion injury in kidneys. However, the roles of p38 mitogen-activated protein kinase (MAPK) in the inflammatory processes of renal ischaemia/reperfusion injury remain to be investigated. We explored the effect of FR167653, a specific inhibitor of p38 MAPK, on renal ischaemia/reperfusion injury in mice.
Methods. The renal artery and vein of the left kidney were occluded with a vascular clamp for 60 min. FR167653 was injected 2 h before or 24 h after renal vessel clamp. Renal tissues were removed for pathological examination 4, 24 or 48 h after reperfusion.
Results. We observed a large number of infiltrated cells and marked acute tubular necrosis in outer medulla after renal ischaemia/reperfusion injury in mice. FR167653 significantly decreased cell infiltration into outer medulla, and the extent of acute tubular necrosis 24 and 48 h after reperfusion. FR167653 markedly decreased the transcription of interleukin-1ß, tumour necrosis factor-
, monocyte chemoattractant protein-1 and regulated upon activation, normal T cell expression and secreted in diseased kidneys. Moreover, FR167653 decreased the number of phosphorylated p38 MAPK-positive cells 4 h after reperfusion.
Conclusion. These results suggest that FR167653 markedly ameliorated renal ischaemia/reperfusion injury, possibly by inhibiting cytokine/chemokine expression and consequent phosphorylation of p38 MAPK in renal tissue.
Keywords: FR167653; kidney; monocyte chemoattractant protein-1; p38 mitogen-activated protein kinase; reperfusion
| Introduction |
|---|
|
|
|---|
Leukocytic infiltration is inevitably associated with ischaemia/reperfusion injury, such as cerebrovascular accident, myocardial ischaemia and ischaemic acute renal failure. Concerning renal diseases, ischaemia/reperfusion is important in renal transplantation, the state of shock for various reasons or renal artery stenosis [1]. Ischaemia/reperfusion injury in the kidney is pathologically characterized by tubular epithelial cell necrosis and/or apoptosis with marked cell infiltration [1]. Various types of mediators, including interleukin (IL)-1ß and tumour necrosis factor (TNF)-
have been reported to participate in the pathogenesis of renal injury after ischaemia/reperfusion [2,3]. In addition, recent studies revealed that a CXC chemokine, IL-8, as well as a CC chemokine, monocyte chemoattractant protein (MCP)-1, are involved in the pathogenesis of experimental ischaemia/reperfusion injury in various organs including the kidney [4] through the infiltration and activation of neutrophils, T cells and macrophages. Moreover, regulated upon activation, normal T-cell expressed and secreted (RANTES) participates in pathogenesis of interstitial renal injury, including renal transplantation [5]. However, the involvement of RANTES in renal ischaemia/reperfusion injury is poorly evaluated. Furthermore, IL-1ß and TNF-
as well as IL-8 stimulate MCP-1 and RANTES expression in mesangial cells, which amplifies the inflammation in the kidney [6]. These cytokines/chemokines may therefore orchestrate in renal inflammation resulting in renal damage after renal ischaemia/reperfusion injury.
Likewise, various types of cytokines/chemokines react with their receptors, which transduce extracellular signals into intracellular response through a mitogen-activated protein kinase (MAPK) signalling cascade [1]. Furthermore, recent studies revealed that p38 MAPK signalling might play an important role in the recruitment and activation of leukocytes via upregulation of various types of chemoattractant protein and adhesion molecules [7,8]. In mesangial and endothelial cells, IL-1ß and TNF-
upregulate MCP-1 expression through a p38 MAPK signalling cascade [9]. However, the precise roles of p38 MAPK on the inflammatory processes of renal ischaemia/reperfusion has not yet been explored.
FR167653 (1-(7-(4-fluorophenyl)-1,2,3,4-tetrahydro-8-(4-pyridyl)pyrazolo(5,1-c)(1,2,4)triazin-2-yl)-2-phenylethanedione sulphate monohydrate) ameliorates ischaemia/reperfusion injury in lung, liver, small intestine and heart via the simultaneous reduction of IL-1ß and TNF-
[10]. FR167653 is characterized by the presence of the pyridine and fluorophenyl rings that are essential for binding to p38 MAPK. Recent crystallographic studies have revealed that FR167653 competes with ATP for binding to p38 MAPK [11]. In addition, a recent study revealed that FR167653 is a p38 MAPK-selective inhibitor without affecting the activities of other protein kinases, such as ERK-1, JNK-2, protein kinase A, protein kinase C, protein kinase G or epidermal growth factor receptor kinase [12]. In contrast to the other p38 MAPK inhibitor SB203580, FR167653 has no effect on cyclooxygenase (COX)-1 or COX-2 activity [13]. In this study, we examined the effects of FR167653 as the specific inhibitor of p38 MAPK on renal ischaemia/reperfusion injury in mice, focusing on the effects of FR167653 on IL-1ß, TNF-
, MCP-1 and RANTES expression, and the phosphorylation of p38 MAPK.
| Materials and methods |
|---|
|
|
|---|
Cell culture
Human renal proximal tubular epithelial cells (TECs) (lot No. CC-2553; Clonetics, MD, USA) were grown in Renal Epithelial Cell Growth Medium (REGM) BulletKit (Clonetics) with 100 µg/ml streptomycin and 100 U/ml penicillin in a humidified atmosphere (5% CO2/95% air) at 37°C. TECs were cultured on collagen type-IV-coated culture plates (Asahi Technoglass Co., Tokyo, Japan).
Stimulation of cultured TECs by IL-1ß and TNF-
Cultured TECs were trypsinized, suspended in REGM, and seeded onto six-well collagen type-IV-coated plates (Asahi Technoglass Co., Tokyo, Japan). TECs treated with or without FR167653 (1x10-6 M) were stimulated with both IL-1ß (10 ng/ml) and TNF-
(20 ng/ml) for 24 h. Total RNA was extracted from TECs using RNA zol B (Tel-Test, Friendswood, TX, USA), a modification of the acid guanidium isothiocyanate-phenolchloroform method [14].
Detection of MCP-1 and RANTES transcripts in cultured TECs
To determine the effects of FR167653 on MCP-1 and RANTES transcripts, total RNA was analysed by reverse transcription polymerase chain reaction (RT-PCR). cDNA was reverse-transcribed from total RNA (1 µg RNA per mouse) using an RT-PCR kit (Takara Shuzo Co. Ltd, Tokyo, Japan). The cDNA product was amplified by PCR. Primers for MCP-1 (5' primer, TTCTGTGCCTGCTGCTCATA; 3' primer, GAGTGAGTGTTCAAGTCTTCG) and RANTES (5' primer, CGGCACGCCTCGCTGTCATC; 3' primer, GCAAGCAGAAACAGGCAAAT) were used. Ten microlitres of PCR products were analysed using 2.0% agarose gel electrophoresis and stained with ethidium bromide. The housekeeping gene GAPDH was used for PCR controls.
Animals
Inbred male Balb/c mice, aged 8 weeks, were obtained from Charles River, Japan Inc. (Atsugi, Kanagawa, Japan). All procedures employed in the animal experiments complied with the standards set out in the Guideline for the Care and Use of Laboratory Animals in Takara-machi Campus of Kanazawa University.
Renal ischaemic model
Mice were anaesthetized with diethyl ether and pentobarbital sodium. The flank incision was made, and the renal artery and vein of the left kidney were occluded with a vascular clamp for 60 min. The clamp was then removed and the organ was allowed to reperfuse. After the clamp was released, the frank incision was closed in two layers with 40 silk sutures. The animals received warm saline instilled into the peritoneal cavity during the procedure and were then allowed to recover with free access to food and water. The right kidney was used as a control in each animal. A control operation was performed in a similar manner, with the exception of clamping the renal vessels.
We performed four separate experiments as follows. In the vehicle group, mice received subcutaneous injection of 1 ml methylcellulose as vehicle 2 h before renal vessel clamp. In the FR group, mice received subcutaneous injection of 32 mg/kg FR167653 in emulsion with 1 ml methylcellulose 2 h before renal vessel clamp. In the day 1 group, mice received subcutaneous injection of 32 mg/kg FR167653 in emulsion with 1 ml methylcellulose 24 h after renal vessel clamp. In the control group, mice received methylcellulose. Plasma concentration of FR167653 reached a peak 2 h after subcutaneous administration (our unpublished data). Four, 24 or 48 h after reperfusion, renal tissues from five mice at each time point in four groups were removed for pathological examination.
Tissue preparation
One portion of the renal tissue was fixed in 10% buffered formalin followed by embedding in paraffin and staining with haematoxylineosin as well as periodic acid-Schiff (PAS) reagent. Two independent observers with no prior knowledge of the experimental design evaluated each section. The observers scored according to a previously described semiquantitative scale designed to evaluate the degree of tubular necrosis [3]. A higher score represented severe damage (maximum score, 4): 0, normal kidney; 1, minimal necrosis (<5% involvement); 2, mild necrosis (525% involvement); 3, moderate necrosis (2575% involvement); 4, severe necrosis (>75% involvement). Interstitial infiltrated cells were counted in 20 randomly selected high power fields (x400) of outer medulla, where cell migration was maximal. The interstitial polymorphonuclear leukocytes were stained using alkaline phosphatase substrates kit II (SK-5200) as previously reported [15]. The other portion of fresh renal tissue, embedded in O.C.T. compound and snap-frozen in N-hexane cooled with a mixture of dry ice and acetone, were cut into 6 µm sections on cryostat (Tissue-Tek systems, Miles, IL, USA). The presence of F4/80-positive macrophages was detected immunohistochemically using rat anti-murine F4/80 monoclonal antibody (clone A3-1; BMA Biomedicals AG, Augst, Switzerland). The total number of interstitial polymorphonuclear leukocytes and F4/80-positive macrophages was counted from >20 randomly selected fields under high power magnification (x400). Total glomerular cell numbers were measured from at least 50 glomeruli for each mouse and expressed as number per glomerular cross section.
Immunohistochemical detection of p38 and phosphorylated p38 MAPK in diseased kidneys
The presence of p38 MAPK and phosphorylated p38 MAPK were demonstrated immunohistochemically in paraffin-embedded tissue specimens 4 h after ischaemia/reperfusion by the indirect avidin-biotinylated peroxidase complex method with rabbit anti-p38 MAPK polyclonal antibodies (10 µg/ml; Santa-Cruz, CA, USA), which react with both
and ß isoforms of p38 and rabbit anti-phosphorylated p38 MAPK polyclonal antibodies (New England Biolabs Inc., MA, USA). We used adult mouse brain for a positive control [16]. p38 and phosphorylated p38 MAPK-positive cells were counted in 20 randomly selected high power fields (x400) of outer medulla. Normal rabbit serum was used as a negative control. Two independent observers, with no prior knowledge of experimental protocols, examined the immunostained sections.
Detection of IL-1ß, TNF-
, MCP-1 and RANTES transcripts in diseased kidneys
To determine the effects of FR167653 on IL-1ß, TNF-
, MCP-1 and RANTES transcription, total RNA was extracted from the whole kidneys from five mice in each group 24 h after reperfusion, in order to perform RT-PCR. cDNA was reverse-transcribed from 5 µg total RNA, combined from five mice in each group (1 µg RNA per mouse), using a RT-PCR kit (Takara Shuzo Co. Ltd). The cDNA product was amplified by PCR. Primers for IL-1ß (5' primer, TTAGACAACTGCACTACAGGCTC; 3' primer, GCTCTGCTTGTGAGGTGCTGATG), TNF-
(5' primer, TCTCATCAGTTCTATGGCCC; 3' primer, GGGAGTAGACAAGGTACAAC), MCP-1 (5' primer, CCTCTCTCTTGAGCTTGGTG; 3' primer, AAGCCAGCTCTCTCTTCCTC) and RANTES (PrimeScreen Mouse RANTES Primer Pair, Biosource International, Camarillo, USA) were used to detect IL-1ß, TNF-
, MCP-1 and RANTES transcription. Ten microlitres of PCR products were analysed using 2.0% agarose gel electrophoresis, and stained with ethidium bromide. The housekeeping gene GAPDH was used for PCR controls.
Statistical analysis
The mean and standard deviation (SD) were calculated for all the parameters determined in this study. Statistical analyses were performed using Wilcoxon rank-sum test, unpaired Student's t-test and ANOVA test. P<0.05 was accepted as statistically significant.
| Results |
|---|
|
|
|---|
FR167653 diminished MCP-1 and RANTES transcripts in cultured human TECs
The stimulation of IL-1ß and TNF-
enhanced MCP-1 and RANTES transcripts in cultured human TECs (Figure 1
|
Interstitial cell infiltration was prevented by administration of FR167653
We observed a large number of infiltrated cells in outer medulla of the diseased kidneys treated with a vehicle (Figure 2A
). The number of infiltrated cells in outer medulla increased after ischaemia/reperfusion until 48 h in vehicle-treated mice. Moreover, FR167653 decreased the number of infiltrated cells at 4 h (control, 20.4±4.7 per visual field; FR167653, 27.8±4.7 per visual field; vehicle, 50.7±13.3 per visual field; P=0.007, n=5 each), 24 h (FR167653, 30.5±12.5 per visual field; vehicle, 147.9±26.2 per visual field, P<0.001, n=5 each) and 48 h (FR167653, 57.6±35.9 per visual field; vehicle, 285.1±22.7 per visual field, P<0.001, n=5 each) after ischaemia/reperfusion compared with vehicle-treated mice (Figures 2B
and 3
). The infiltrated cells in the corticomedullary junction of vehicle-treated kidneys were mainly polymorphonuclear cells or macrophages 24 h after reperfusion. In contrast, FR167653-treated mice had a significantly decreased number of infiltrated polymorphonuclear cells and macrophages 24 h after reperfusion compared with that of vehicle-treated mice (Figure 2
; Table 1
). The histological features of control-operated left and right kidneys were essentially the same as normal kidneys (Figure 2C
).
|
|
|
Administration of FR167653 significantly decreased the extent of acute tubular necrosis
Marked acute tubular necrosis was observed after ischaemia/reperfusion in cortex and outer medulla in mice treated with vehicle at 24 and 48 h after ischaemia/reperfusion (Figure 2B
). The scores of acute tubular necrosis in FR167653-treated mice were significantly lower in vehicle-treated mice at 24 and 48 h after ischaemia/reperfusion both in cortex (FR167653, 0.7±0.7, vs vehicle, 3.0±1.2, at 24 h, P<0.001; and FR167653, 1.1±1.1, vs vehicle, 3.6±0.2, at 48 h, P<0.001, n=5 each) and outer medulla (FR167653, 1.7±1.3, vs vehicle, 3.6±0.5, at 24 h, P=0.01; FR167653, 2.3±2.1, vs vehicle, 4.0±0.0, at 48 h, P=0.02, n=5 each) (Figure 4
). However, acute tubular necrosis was hardly detected in the kidneys of control-operated mice or normal mice (Figures 2C
and 4
). Moreover, the number of infiltrated cells correlated well with the scores of acute tubular necrosis on cortex and outer medulla in mice treated with FR167653 and vehicle (cortex, r=0.83, P<0.001; outer medulla, r=0.70, P<0.001; n=30 each). In contrast, glomerular injury was faintly detected after ischaemia/reperfusion injury (Figures 2
and 5
). The number of cells in glomeruli did not differ among FR167653-treated mice, vehicle-treated mice and control-operated mice at any time point after ischaemia/reperfusion (Figure 5
).
|
|
The effect of FR167653 administered after ischaemia/reperfusion
To determine the impact of FR167653 after ischaemia/ reperfusion on renal pathology, we administered FR167653 24 h after reperfusion. FR167653 ameliorated the number of infiltrated cells 48 h after reperfusion compared with that of vehicle-treated mice (FR167653, 234.7±68.8 per visual field; vehicle, 285.1±22.7 per visual field; P=0.006, n=5 each). However, the scores of acute tubular necrosis in mice treated with FR167653 48 h after reperfusion did not differ from those of vehicle-treated mice, either in the cortex (2.8±1.3 vs 3.6±0.2, P=0.13, n=5 each) or the outer medulla (3.2±1.3 vs 4.0±0.0, P=0.24, n=5 each).
Inhibition of IL-1ß, TNF-
, MCP-1 and RANTES message expression by FR167653
To clarify the impacts of FR167653 on renal mRNA expression of IL-1ß, TNF-
, MCP-1 and RANTES, all of which are presumed to be involved in ischaemia/reperfusion, IL-1ß, TNF-
, MCP-1 and RANTES transcripts were faintly detected in control-operated left kidneys (Figure 6
, lane A) or contralateral kidneys (data not shown). Ischaemia/reperfusion enhanced renal IL-1ß, TNF-
, MCP-1 and RANTES expression in diseased kidneys (Figure 6
, lane B), and enhanced IL-1ß, TNF-
, MCP-1 and RANTES mRNA expression was markedly decreased by treatment with FR167653 (Figure 6
, lane C).
|
Phosphorylated p38 MAPK was detected in diseased kidneys and reduced by FR167653 treatment
To determine the effects of FR167653 on the phosphorylation of p38 MAPK, we detected p38 MAPK and phosphorylated p38 MAPK-positive cells in the diseased kidneys after ischaemia/reperfusion by immunohistochemical analyses. The staining was specific because a non-specific isotype-matched control IgG or antigen-absorbed antibodies did not give a positive staining (data not shown). p38 MAPK was detected in glomerular cells, tubular epithelial cells and infiltrated cells 4 h after ischaemia/reperfusion in mice treated with either FR167653 or vehicle, or control-operated mice, and the number of p38 MAPK-positive cells did not differ among these mice 4 h after ischaemia/reperfusion (control, 265.0±45.4 per visual field; FR167653, 294.4±63.4 per visual field; vehicle, 282.2±60.5 per visual field; n=5 each) (Figure 7A
and B
). However, only a small number of phosphorylated p38 MAPK-positive cells were detected in the control-operated left kidneys (3.1±0.5 per visual field, n=5). Phosphorylated p38 MAPK was detected massively in the nuclei of glomerular cells, tubular epithelial cells and infiltrated cells 4 h after ischaemia/reperfusion in the kidneys of mice treated with vehicle (Figure 8A
). Treatment with FR167653 dramatically reduced phosphorylated p38 MAPK-positive cells in ischaemia/reperfusion kidneys (FR167653, 4.6±1.7 per visual field vs vehicle, 63.1±20.8 per visual field; P<0.001, n=5 each) (Figure 8B
).
|
|
| Discussion |
|---|
|
|
|---|
This study demonstrated that a new anti-inflammatory compound, FR167653, dramatically reduced acute cell infiltration and tubular necrosis in a renal ischaemia/reperfusion model in mice. Furthermore, FR167653 markedly reduced transcription of IL-1ß, TNF-
, MCP-1 and RANTES, and p38 MAPK phosphorylation in vivo. In the present study, we showed that FR167653 directly reduced the expression of MCP-1 and RANTES in cultured TECs. Ohashi et al. reported that FR167653 inhibited LPS-induced p38 MAPK activity of cultured cells in a concentration-dependent manner [17]. Moreover, p38 MAPK signalling cascades are critical for the production of MCP-1 and RANTES [9,18]. Taken together, these findings suggest that FR167653 directly reduced the expression of MCP-1 and RANTES through the inhibition of p38 MAPK activity.
We demonstrated that ischaemia/reperfusion induced marked cell infiltration in the outer medulla and acute tubular necrosis. IL-1ß and TNF-
are potent pro-inflammatory cytokines, and may play a key role in ischaemia/reperfusion models of various organs, including the kidney [2,3]. Furthermore, IL-1ß and TNF-
stimulate E-selectin, intercellular adhesion molecule (ICAM)-1 and vascular cell adhesion molecule (VCAM)-1 mRNA expression and protein synthesis [7], which are critical in leukocyte recruitment and infiltration into the injury site. Infiltrated cells were activated by various types of cytokines, including IL-1ß and TNF-
, and released lysosomal enzyme, prostaglandin and reactive oxygen intermediates, which eventually induced renal tubular necrosis [2,3]. Previous reports suggested that FR167653 has a capacity to suppress IL-1ß and TNF-
production [10]. In fact, renal pathology was improved by FR167653 treatment. Moreover, the number of infiltrated cells correlated well with the scores of acute tubular necrosis. Thus, FR167653 may inhibit expression of pro-inflammatory cytokines and adhesion molecules through blocking IL-1ß and TNF-
production, resulting in the inhibition of the inflammatory cell infiltration and tubular necrosis in ischaemia/reperfusion kidney.
Chemokines are reported to be key molecules for cell infiltration. MCP-1 has a capacity to recruit macrophages to the site of inflammation in various organs [19]. Concomitantly, we reported previously that MCP-1 participates in tissue injury by cell infiltration and activation in human glomerulonephritis and experimental models in rats [20,21]. Furthermore, MCP-1 and RANTES expression were upregulated through IL-1ß and TNF-
[9,22]. Moreover, RANTES participates in renal injury, including renal allograft biopsies of patients undergoing rejection, through an activation of macrophages and T cells [5]. In this study, we demonstrated that MCP-1 and RANTES mRNA expression were dramatically suppressed by treatment with FR167653. Thus, FR167653 may decrease MCP-1 and RANTES expression directly or indirectly via the suppression of IL-1ß and TNF-
production, and in turn ameliorates cell infiltration and acute tubular necrosis in ischaemia/reperfusion injury.
Several lines of evidence indicate that cognate receptors for IL-1ß, TNF-
and chemokines utilize the p38 MAPK signalling cascade [8]. Moreover, p38 MAPK signalling cascades are important for the production of cytokines, chemokines and adhesion molecules, such as E-selectin, ICAM-1, VCAM-1, MCP-1 and RANTES [79]. Therefore, p38 MAPK phosphorylation may be involved in both the signal transduction and production of cytokines/chemokines [8]. We detected phosphorylated p38 MAPK in the early stages of the ischaemia/reperfusion model in mice. Moreover, FR167653 decreased the number of phosphorylated p38 MAPK-positive cells. These findings suggest that phosphorylation of p38 MAPK may be involved in ischaemia/reperfusion injury accompanied by upregulated IL-1ß, TNF-
, MCP-1 and RANTES mRNA expression, and with their receptors. Despite this, the direct impacts of FR167653 on p38 MAPK remain unclear at this moment. At least, the reduction of cytokines and chemokines by FR167653 may lead phosphorelation of p38 MAPK, through their receptors. Collectively, modulating p38 MAPK phosphorelation offers possible therapeutic approaches to halt the cascade of events culminating in renal injury.
FR167653 partially ameliorated cell infiltration compared with vehicle-treated mice when FR167653 was administered after the onset of reperfusion. These results suggest that FR167653 may be effective even after renal damage has already commenced. Collectively, FR167653 may be an appealing therapeutic tool with which to combat already established human renal ischaemia/reperfusion injury where cytokines and/or chemokines play an important role in pathogenesis.
Ischaemia/reperfusion injury is responsible for various types of renal injury. In particular, all renal allografts suffer unavoidable ischaemic injury from the transplant process. Moreover, the extent of acute tubular necrosis at transplant may influence the long-term outcome of the transplanted kidney [23]. Thus, prevention of acute renal injury at transplantation may be ideal for improving the outcome of renal transplantation. As FR167653 dramatically reduced acute tubular necrosis in a renal ischaemia/reperfusion model, FR167653 may offer the clinical therapeutic approach necessary to improve the outcome of renal transplantation by inhibiting ischaemia/reperfusion injury of donor organs.
In summary, we have observed that FR167653 markedly ameliorates cell infiltration and tubular necrosis, possibly through reducing IL-1ß, TNF-
, MCP-1 and RANTES mRNA expression, and consequently inhibits the phosphorylation of p38 MAPK in a renal ischaemia/reperfusion model in mice.
| Notes |
|---|
Correspondence and offprint requests to: Dr Kengo Furuichi, Department of Gastroenterology and Nephrology, Kanazawa University Graduate School of Medicine, 13-1 Takara-machi, Kanazawa 920-8641, Japan. Email: kfuruichi{at}medf.m.kanazawa\|[hyphen]\|u.ac.jp
| References |
|---|
|
|
|---|
- Grace PA. Ischemia-reperfusion injury. Br J Surg1994; 81: 637647[Web of Science][Medline]
- Donnahoo KK, Shames BD, Harken AH, Meldrum DR. The role of tumor necrosis factor in renal ischemia-reperfusion injury. J Urol1999; 162: 196203[Web of Science][Medline]
- Haq M, Norman J, Saba SR, Ramirez G, Rabb H. Role of IL-1 in renal ischemic reperfusion injury. J Am Soc Nephrol1998; 9: 614619[Abstract]
-
Mizutani A, Okajima K, Uchiba U, Noguchi T. Activated protein C reduces ischemia/reperfusion-induced renal injury in rats by inhibiting leukocyte activation. Blood2000; 95: 37813787
[Abstract/Free Full Text] - Pattison J, Nelson PJ, Huie P et al. RANTES chemokine expression in cell-mediated transplant rejection of the kidney. Lancet1994; 343: 209211[Web of Science][Medline]
-
Luo Y, Lloyd C, Gutierrez-Ramos JC, Dorf ME. Chemokine amplification in mesangial cells. J Immunol1999; 163: 39853992
[Abstract/Free Full Text] - Collins T, Read MA, Neish AS, Whitley MZ, Thanos D, Maniatis T. Transcriptional regulation of endothelial cell adhesion molecules: NF-kappa B and cytokine-inducible enhancers. FASEB J1995; 9: 899909[Abstract]
- Herlaar E, Brown Z. p38 MAPK signaling cascades in inflammatory disease. Mol Med Today1999; 5: 439447[Web of Science][Medline]
-
Goebeler M, Kilian K, Gillitzer R et al. The MKK6/p38 stress kinase cascade is critical for tumor necrosis factor-alpha-induced expression of monocyte-chemoattractant protein-1 in endothelial cells. Blood1999; 93: 857865
[Abstract/Free Full Text] - Kawano T, Ogushi F, Tani K et al. Comparison of suppressive effects of a new anti-inflammatory compound, FR167653, on production of PGE2 and inflammatory cytokines, human monocytes, and alveolar macrophages in response to endotoxin. J Leukoc Biol1999; 65: 8086[Abstract]
- Wilson KP, McCaffrey PG, Hsiao K et al. The structural basis for the specificity of pyridinylimidazole inhibitors of p38 MAP kinase. Chem Biol1997; 4: 423431[Web of Science][Medline]
-
Takahashi S, Keto Y, Fujita T, Uchiyama T, Yamamoto A. FR167653, a p38 mitogen-activated protein kinase inhibitor, prevents Helicobacter pylori-induced gastritis in Mongolian gerbils. J Pharmacol Exp Ther2001; 296: 4856
[Abstract/Free Full Text] -
Börsch-Haubold AG, Pasquet S, Watson SP. Direct inhibition of cyclooxygenase-1 and -2 by the kinase inhibitors SB203580 and PD98059: SB203580 also inhibits thromboxane synthase. J Biol Chem1998; 273: 2876628772
[Abstract/Free Full Text] - Pertosa G, Grandaliano G, Gesualdo L, Ranieri E, Monno R, Schena FP. Interleukin-6, interleukin-8 and monocyte chemotactic peptide-1 gene expression and protein synthesis are independently modulated by hemodialysis membranes. Kidney Int1998; 54: 570579[Medline]
-
Wada T, Tomosugi N, Naito T et al. Prevention of proteinuria by the administration of anti-interleukin 8 antibody in experimental acute immune complex-induced glomerulonephritis. J Exp Med1994; 180: 11351140
[Abstract/Free Full Text] - Lee SH, Park J, Che Y, Han PL, Lee JK. Constitutive activity and differential localization of p38alpha and p38beta MAPKs in adult mouse brain. J Neurosci Res2000; 60: 623631[Web of Science][Medline]
-
Ohashi N, Matsumori A, Furukawa Y et al. Role of p38 mitogen-activated protein kinase in neointimal hyperplasia after vascular injury. Arterioscler Thromb Vasc Biol2000; 20: 25212526
[Abstract/Free Full Text] -
Kujime K, Hashimoto S, Gon Y, Horie T. p38 mitogen-activated protein kinase and c-jun-NH2-terminal kinase regulate RANTES production by influenza virus-infected human bronchial epithelial cells. J Immunol2000; 164: 32223228
[Abstract/Free Full Text] -
Matsushima K, Larrsen CG, DuBois GC, Oppenheim JJ. Purification and characterization of a novel monocyte chemotactic and activating factor produced by a human myelomonocytic cell line. J Exp Med1989; 169: 14851490
[Abstract/Free Full Text] - Wada T, Yokoyama H, Furuichi K et al. Intervention of crescentic glomerulonephritis by antibodies to monocyte chemotactic and activating factor (MCAF/MCP-1). FASEB J1996; 10: 14181425[Abstract]
-
Wada T, Furuichi K, Segawa C et al. MIP-1
and MCP-1 contribute to crescents and interstitial lesions in human crescentic glomerulonephritis. Kidney Int1999; 56: 9951003[Web of Science][Medline]
-
Deckers JG, Van Der Woude FJ, Van Der Kooij SW, Daha MR. Synergistic effect of IL-1
, IFN-
, and TNF-
on RANTES production by human renal tubular epithelial cells in vitro. J Am Soc Nephrol1998; 9: 194202[Abstract]
- Moustafa F, Sobh M, El-Sherif A, Fakhry A, Ghoneim M. Study of morphologic risk factors in graft biopsies from patients with living related donor kidney transplants. Am J Nephrol1996; 16: 98105[Medline]
Revision received 24.10.01.
This article has been cited by other articles:
![]() |
C. Doucet, S. Milin, F. Favreau, T. Desurmont, E. Manguy, W. Hebrard, Y. Yamamoto, G. Mauco, M. Eugene, V. Papadopoulos, et al. A p38 mitogen-activated protein kinase inhibitor protects against renal damage in a non-heart-beating donor model Am J Physiol Renal Physiol, July 1, 2008; 295(1): F179 - F191. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Li, N. V. Campanale, R. J. Liang, J. A. Deane, J. F. Bertram, and S. D. Ricardo Inhibition of p38 Mitogen-Activated Protein Kinase and Transforming Growth Factor-{beta}1/Smad Signaling Pathways Modulates the Development of Fibrosis in Adriamycin-Induced Nephropathy Am. J. Pathol., November 1, 2006; 169(5): 1527 - 1540. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Prakash, M. Sandovici, V. Saluja, M. Lacombe, R. Q. J. Schaapveld, M. H. de Borst, H. van Goor, R. H. Henning, J. H. Proost, F. Moolenaar, et al. Intracellular Delivery of the p38 Mitogen-Activated Protein Kinase Inhibitor SB202190 [4-(4-Fluorophenyl)-2-(4-hydroxyphenyl)-5-(4-pyridyl)1H-imidazole] in Renal Tubular Cells: A Novel Strategy to Treat Renal Fibrosis J. Pharmacol. Exp. Ther., October 1, 2006; 319(1): 8 - 19. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Kher, K. K. Meldrum, K. L. Hile, M. Wang, B. M. Tsai, M. W. Turrentine, J. W. Brown, and D. R. Meldrum Aprotinin improves kidney function and decreases tubular cell apoptosis and proapoptotic signaling after renal ischemia-reperfusion J. Thorac. Cardiovasc. Surg., September 1, 2005; 130(3): 662 - 662. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Koshikawa, M. Mukoyama, K. Mori, T. Suganami, K. Sawai, T. Yoshioka, T. Nagae, H. Yokoi, H. Kawachi, F. Shimizu, et al. Role of p38 Mitogen-Activated Protein Kinase Activation in Podocyte Injury and Proteinuria in Experimental Nephrotic Syndrome J. Am. Soc. Nephrol., September 1, 2005; 16(9): 2690 - 2701. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Ramesh and W. B. Reeves p38 MAP kinase inhibition ameliorates cisplatin nephrotoxicity in mice Am J Physiol Renal Physiol, July 1, 2005; 289(1): F166 - F174. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Ohashi, T. Nakagawa, S. Watanabe, J. Kanellis, R. G. Almirez, G. F. Schreiner, and R. J. Johnson Inhibition of p38 Mitogen-Activated Protein Kinase Augments Progression of Remnant Kidney Model by Activating the ERK Pathway Am. J. Pathol., February 1, 2004; 164(2): 477 - 485. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. C. Lenhard, S. S. Nerurkar, T. R. Schaeffer, R. C. Mirabile, R. W. Boyce, D. F. Adams, B. M. Jucker, and R. N. Willette p38 MAPK Inhibitors Ameliorate Target Organ Damage in Hypertension: Part 2. Improved Renal Function as Assessed by Dynamic Contrast-Enhanced Magnetic Resonance Imaging J. Pharmacol. Exp. Ther., December 1, 2003; 307(3): 939 - 946. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Furuichi, T. Wada, Y. Iwata, K. Kitagawa, K.-i. Kobayashi, H. Hashimoto, Y. Ishiwata, N. Tomosugi, N. Mukaida, K. Matsushima, et al. Gene Therapy Expressing Amino-Terminal Truncated Monocyte Chemoattractant Protein-1 Prevents Renal Ischemia-Reperfusion Injury J. Am. Soc. Nephrol., April 1, 2003; 14(4): 1066 - 1071. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||












