Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (4)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Yard, B.
Right arrow Articles by van der Woude, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yard, B.
Right arrow Articles by van der Woude, F.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Nephrol Dial Transplant (2002) 17: 386-391
© 2002 European Renal Association-European Dialysis and Transplant Association

Influence of high glucose concentrations on the expression of glycosaminoglycans and N-deacetylase/N-sulphotransferase mRNA in cultured skin fibroblasts from diabetic patients with or without nephropathy

Benito Yard, Yuxi Feng, Hanno Keller, Christa Mall and Fokko van der Woude

Vth Medical Clinic, Klinikum Mannheim, Faculty for Clinical Medicine, Heidelberg University, Mannheim, Germany



   Abstract
 Top
 Abstract
 Introduction
 Subjects and methods
 Results
 Discussion
 References
 
Background. The Steno hypothesis postulates that a genetic defect in the regulation of the production of heparan sulphate by renal and non-renal cells determines susceptibility for the development of proteinuria and macro-angiopathy in patients with diabetic nephropathy (DN).

Methods. To test this hypothesis, skin fibroblasts isolated from type II diabetic patients with overt DN, micro-albuminuria, or without DN and from non-diabetic patients (n=8 for each group) were cultured in the presence of 5 or 25 mM D-glucose or in 25 mM L-glucose, and tested for the expression of N-deacetylase/N-sulphotransferase (NDST) 1 and 2 by semi-quantitative RT–PCR. Proteoglycan production was measured by means of metabolic labelling.

Results. In each group of patients, 25 mM D-glucose significantly reduced the incorporation of [3H]glucosamine (P<0.01), but not [35S]sulphate. The quantity of NDST 1 mRNA expression did not differ between the four groups. In the non-diabetic group only, 25 mM D-glucose significantly increased NDST 1 mRNA expression (P<0.01). In contrast, NDST 2 mRNA expression was reduced by 25 mM D-glucose in all groups (P<0.01). In the diabetic patients, NDST 2 mRNA was significantly reduced compared with the non-diabetic patients. No differences were found between patients with or without nephropathy. In mesangial cells (MC), NDST expression was not influenced by glucose.

Conclusions. Since NDST 1 and 2 are not differentially expressed in patients with or without nephropathy and, in MC, the mRNA expression hereof is not influenced by glucose as in skin fibroblasts, our data do not support the Steno hypothesis.

Keywords: diabetic-nephropathy; fibroblasts; glucose; N-deacetylase/N-sulphotransferase; proteoglycans; skin



   Introduction
 Top
 Abstract
 Introduction
 Subjects and methods
 Results
 Discussion
 References
 
Diabetic nephropathy (DN) is characterized by mesangial expansion and thickening of the glomerular basement membrane (GBM) [1]. In addition, the expression of heparan sulphate (HS) proteoglycans (PGs) is strongly reduced in the GBM and mesangial matrix of these patients [2,3]. It is believed that the negatively charged HS glycosaminoglycans (HS-GAGs) play a fundamental role in the integrity and function of the glomerular filter. In vivo binding of monoclonal antibodies to HSPG in the GBM can induce a selective proteinuria in rats as could be demonstrated by van der Born et al. [4]. Moreover, enzymatic degradation of HS by heparitinase resulted in the transcapillary passage of anionic ferritin and albumin into the urinary space [5].

HSPGs consist of a central core protein to which HS-GAG side chains are linked. To date, three core proteins, perlecan, agrin and collagen XVIII [6,7], have been identified in the GBM. The HS-GAG side chains are formed by repeating disaccharide units, consisting of hexuronate and hexosamine. Sulphate groups, covalently linked to the repeating disaccharides, and carboxyl groups give the HS-GAGs their highly negative charge. The biochemical processing of HS-GAG is extremely complex and involves a variety of enzymes required for the sulphation of the disaccharide chain [8]. A key player in this process is the N-deacetylase/N-sulphotransferase (NDST) enzyme, which substitutes the N-acetyl moiety of the glucosamine for a sulphate group. This initial step is required for further sulphation of the HS-GAG chain and, therefore, the NDST enzyme is of fundamental importance in the sulphation of HS. Several genes encoding for the NDST protein have now been identified [9].

Only a subset of diabetic patients (20–40%) will develop DN. This may be explained by a genetic defect in a subset of individuals who are vulnerable to the development of nephropathy under hyperglycaemic conditions. Moreover, the development of micro-albuminuria, the first sign of DN, is strongly related to a very high cardiovascular morbidity and mortality [10]. It was therefore suggested that systemic changes leading to micro- and macro-angiopathy may underlie systemic changes in the extracellular matrix (ECM). Both the genetic defect and systemic changes have been combined in the Steno hypothesis, which postulates that a genetic defect in the regulation of HS production determines the susceptibility to, and hence the development of, proteinuria and angiopathy [10]. According to this hypothesis, albuminuria and associated complications result from a genetic polymorphism of a key enzyme involved in the metabolism of HS. A genetic polymorphism of the NDST enzyme with subsequent changes in activity due to hyperglycaemia would thus lead to significant qualitative changes to HS in susceptible diabetic patients. Although this is an intriguing hypothesis, it is highly speculative. Earlier data in van der Pijl et al. [11], which showed a decreased expression of HS-GAG in the skin basement membrane of diabetic patients with nephropathy, but not in diabetic patients without nephropathy, seems to support this hypothesis in a broad sense.

In the present paper, we therefore addressed the question of whether skin fibroblasts from DN patients differ from those of diabetic and non-diabetic patients without nephropathy with respect to the expression and or regulation of PG, NDST 1 and 2 mRNA under hyperglycaemic conditions. Moreover, it was investigated whether high glucose concentrations had similar effects for NDST 1 and 2 in skin fibroblasts and MC, to those predicted by the Steno hypothesis.



   Subjects and methods
 Top
 Abstract
 Introduction
 Subjects and methods
 Results
 Discussion
 References
 
Patients
All patients were selected from the ‘V. Medizinische Universitätsklinik, Klinikum Mannheim’ of the Ruprecht Karls University of Heidelberg and gave informed consent for this study. The study protocol had been approved by the Medical Ethical Committee of the Faculty for Clinical Medicine at Heidelberg University, Mannheim. There were 24 type II diabetic patients with or without nephropathy and eight non-diabetic patients, without a history of renal complications, included in the study. They were classified in the following four groups (n=8 for each group):

D2: patients with diabetes mellitus and overt DN.
D1: patients with diabetes mellitus and persistent micro-albuminuria.
D0: patients with diabetes but without micro-albuminuria.
C: non-diabetic patients without nephropathy.

Demographic and clinically relevant characteristics of the patients are listed in Table 1Go. In this study, proteinuria (group D2) was defined as all of the following criteria: the presence of urine albumin excretion >300 mg/24 h, an albumin:creatinine ratio of >300 mg/g, a protein reading of at least (+), albumin reading at least 100 mg/l in reagent strip (Micral-Test® II, Roche Diagnostics, Mannheim, Germany) in at least two of three morning urine samples, presence of diabetic retinopathy, absence of urinary tract infections, absence of kidney diseases other than DN and absence of heart failure or fever. Micro-albuminuria (group D1) was defined as all of the following criteria: the presence of urine albumin (30–300 mg/24 h), albumin:creatinine ratio of 20–300 mg/g and albumin reading of 20–100 mg/l in reagent strips in at least two of three morning urine samples, presence of diabetic retinopathy, absence of urinary tract infections, absence of kidney diseases other than DN and absence of heart failure or fever. Normo-albuminuria (group D0) was defined as all of the following criteria in patients with a duration of diabetes mellitus of at least 15 years: the presence of urine albumin excretion <30 mg/24 h, albumin:creatinine ratio of <20 mg/g, negative reading of albumin and protein in reagent strips in at least two of three morning urine samples. Renal biopsies were not performed for the diagnosis of DN. Therefore, diabetic retinopathy was required for the diagnosis of DN.


View this table:
[in this window]
[in a new window]
 
Table 1.  Demographic and clinical characteristics of the patients studied

 

Cell culture
Primary cultures of skin fibroblast were established from skin biopsies taken from the anterior tibia. The fibroblasts were grown in 25 cm2 tissue culture flasks (Falcon, Frickenhausen, Germany) in RPMI 1640 medium (Gibco BRL, Eggenstein, Germany) supplemented with 10% heat inactivated fetal bovine serum (Gibco BRL), 100 U/ml penicillin and 100 µg/ml streptomycin (Sigma, St Louis, MO, USA) at 37 °C, in an atmosphere of 5% CO2 and 95% humidity. The medium was changed every 3 days until the cells were confluent, then the cells were seeded (1:3) into new flasks by Trypsin 0.025%, EDTA 0.01% (Cell System, Heidelberg, Germany). All experiments were performed using cells from the 5th or 6th passage. At that point the fibroblasts were split into six-well plates, grown to 70% confluency and then cultured for 3 days in medium containing 5 mM D-glucose, 25 mM D-glucose or 25 mM L-glucose (all from Sigma) as an osmotic control.

MC were cultured from normal renal tissue acquired from multiple sources including allografts unsuitable for transplantation and from normal surgical nephrectomy specimens. Cells were subcultured from hillocks, usually appearing 3 weeks after outgrowth of the glomeruli, in 24-well plates (Greiner, Frickenhausen, Germany) in DMEM supplemented with 10% heat inactivated fetal calf serum (Gibco BRL). Single wells were trypsinized and seeded into T25-culture flask on the basis of cell morphology (multilayer, spindle shaped) and the absence of epithelial cells with cobblestone morphology. MC were characterized by uniform staining with FITC-phalloidin for actin, a positive staining with monoclonal antibodies against vimentin and the absence of staining using monoclonal antibodies against von Willebrand factor, cytokeratin and desmin. All experiments were performed in triplicate and repeated at least twice for each cell line.

Metabolic labelling
In order to determine the effect of high glucose concentrations on the production of PG in skin fibroblasts, the cells were stimulated with 5 mM and 25 mM D-glucose or 25 mM L-glucose for 72 h. The medium was replaced with sulphate-free DMEM, containing the same glucose concentration as above, 24 h after the onset of the experiment. After an additional culture period of 24 h, 10 µCi/ml [35S]sulphate and 10 µCi/ml [3H]glucosamine (both from Amersham, Heidelberg, Germany) was added to the cells. The supernatants were collected and the ECM was extracted using 4 M guanidine/HCl, after 24 h of metabolic labelling. Both fractions were then dialysed against 0.5 M sodium carbonate containing PMSF and proteinase inhibitors. GAGs were isolated from the dialysed supernatant and ECM with cetylpyridinium chloride (CPC) as described [12]. The radioactivity, associated with the GAG-precipitate, was measured by ß-scintillation counting (Beckman, LS 6500) using different channels for 35S and 3H.

Semiquantitative RT–PCR
For semiquantitative evaluation of NDST mRNA expression in cultured skin fibroblasts, the cells were stimulated with 5 and 25 mM D-glucose, 25 mM L-glucose for 72 h in DMEM. Total RNA was isolated using Trizol-Reagent (Gibco BRL) according to the manufacturer's instructions. One microgram of total RNA was reverse transcribed into cDNA using SuperScriptTM II RNase H Reverse Transcriptase-Kit (Gibco BRL) according to the manufacturer's instructions.

The oligonucleotides used for amplification were constructed from the cloned sequence of GAPDH, NDST 1 and 2, and were as follows:

GAPDHforward: 5'GTCTTCACCACCATGGAGAA3'
GAPDHreverse: 5'ATCCACAGTCTTCTGGGTGG3'
NDST1forward: 5'CGCTTCCTAAGTCTCTGTGA3'
NDST1reverse: 5'CAATCTCTGTGCGGTATTTG3'
NDST2forward: 5'TGTTCCTCCCAATGCCAGC3'
NDST2reverse: 5'CTCTTGCCCATCCACAATC3'.

Serial dilutions of cDNA of all samples were first amplified for both GAPDH and NDST as described below to assess the dilutions of cDNA at which a linear relationship between dilution and amplification product occurred. To each dilution of cDNA, the following reagents were added. Ten picomoles of each primer and 0.5 pmol Taq-DNA-polymerase were added to a final volume of 50 µl (50 mM KCl, 10 mM Tris–HCl pH 8.32, 2 mM MgCl2, 2 mg/ml BSA, 0.25 mM each dNTP). The mixture was heated at 95 °C for 5 min followed by 25 cycles, each consisting of incubation periods of 2.5 min at 95 °C, 1.5 min at 56 °C (for GAPDH and NDST 2) or 62 °C (for NDST 1) and 1.0 min at 72 °C. After termination of the last cycle the samples were chilled at 4 °C.

PCR products were resolved by electrophoresis in 1% agarose (Serva, Boehringer Ingelheim, Germany) and recorded by digital camera. Afterwards, the intensity of the bands was plotted against the dilution of the cDNA for both GAPDH and NDST 1 or 2. For each sample and for each condition three different dilutions were tested to assure linearity between dilution and amplification product. All patients were tested for each condition in triplicate. The data were analysed in the range where there was a linear relationship between the amount of PCR product and cDNA dilution.

Statistical analysis
The significance was assessed by application of Stata Statistical software, using ANOVA and Student's t-test for paired samples. A P value <0.05 was used to determine significance.



   Results
 Top
 Abstract
 Introduction
 Subjects and methods
 Results
 Discussion
 References
 
To study the influence of high glucose concentrations on GAG production in skin fibroblasts, isolated from NIDDM patients with or without nephropathy and from non-diabetic patients, the incorporation of [3H]glucosamine and [35S]sulphate into GAG was determined. To this end, skin fibroblasts from these patients were cultured in 5 or 25 mM D-glucose or 25 mM L-glucose as osmotic control. The production of GAG did not differ between the groups, when the cells were cultured in either 5 or 25 mM D-glucose. This was true for GAG, whether isolated from the supernatant (Figure 1AGo) or from the ECM (data not shown) of the cells. There was, however, a significant decrease in the incorporation of [3H]glucosamine in GAG, isolated from both the supernatant and the ECM, when the cells were cultured in the presence of 25 mM compared with 5 mM D-glucose (P<0.01). This effect was observed in all groups and was not specific for the diabetic or nephropathic groups (Figure 1BGo). No influence of 25 mM L-glucose on GAG production was observed (data not shown). Although there was a decrease in the incorporation of [3H]glucosamine, it was not accompanied by a concomitant decrease in [35S]sulphate incorporation (data not shown). These data therefore suggest that glucose treatment does not affect the sulphation of the GAG chains, although it may affect the production of these chains or cellular uptake of glucosamine.



View larger version (20K):
[in this window]
[in a new window]
 
Fig. 1.  Incorporation of [3H]glucosamine into GAG. (A) GAG isolated from the supernatants of skin fibroblasts that were cultured in plain culture medium for 72 h. C, skin fibroblasts from non-diabetic patients; D0, skin fibroblasts from diabetic patients without micro-albuminuria; D1, skin fibroblasts from diabetic patients with persistent micro-albuminuria; D2, skin fibroblasts from diabetic patients with overt DN. No significant differences were observed between the four groups (ANOVA). (B) Comparison of the incorporation of [3H]glucosamine into GAG of skin fibroblasts that were cultured in 5 mM (•) and 25 mM D-glucose ({circ}). Significance was analysed by Student's t-test for paired samples. C, D0, D1 and D2: as in (A).

 
Inasmuch as the NDST enzymes are of crucial importance for the sulphation of HS-GAG, it was investigated whether high glucose concentrations could influence the mRNA expression of two NDST enzymes, i.e. NDST 1 and 2. To this end, cells from patients in all four groups were cultured in different glucose concentrations as mentioned above. NDST 1 and 2 mRNA expression was studied by means of semiquantitative RT–PCR as described in Subjects and methods.

It was found that the range in NDST 1 mRNA expression varied to a larger extent in the diabetic groups, but there were no significant differences in the amount of NDST 1 mRNA expressed in the four groups, when the cells were cultured in the presence of either 5 or 25 mM D-glucose. Interestingly, however, 25 mM D-glucose increased the expression of NDST 1 mRNA significantly, but only in the non-diabetic group. Although some of the fibroblasts from the diabetic patients responded to high glucose concentration by increasing their NDST 1 expression, there was no general consistency compared with the non-diabetic group (Figure 2AGo). In contrast to NDST 1 mRNA expression, it was found that the quantity of NDST 2 mRNA was significantly decreased in the diabetic groups, even when the skin fibroblasts were cultured under normal glucose conditions (P<0.001) (Figure 2BGo). No differences herein were found in patients with or without nephropathy. The expression of NDST 2 was significantly inhibited by 25 mM D-glucose in all four groups (Figure 2BGo). This did not occur when the cells were cultured in the presence of 25 mM L-glucose (data not shown), suggesting a specific effect of D-glucose in the down-regulation of NDST 2 mRNA.



View larger version (27K):
[in this window]
[in a new window]
 
Fig. 2.  NDST 1 and 2 mRNA expression in cultured skin fibroblasts. (A) NDST 1 mRNA expression in skin fibroblasts from non-diabetic patients (C), diabetic patients without nephropathy (D0), diabetic patients with persistent microalbuminuria (D1) and with overt nephropathy (D2). (B) NDST 2 mRNA expression depicted as in (A). The cells were cultured in the presence of 5 mM (•) or 25 mM D-glucose ({circ}) for 72 h. Results are expressed as NDST 1 or 2/GAPDH ratio. Differences between the groups were analysed by ANOVA, and differences between 5 and 25 mM D-glucose were analysed by Student's t-test for paired samples.

 
To test whether high glucose concentrations had similar effects on NDST 1 and 2 expression in MC, the mRNA expression for these two enzymes was investigated in the same way as for skin fibroblasts in eight different MC lines. The mRNA expression for NDST 1 did not differ when the cells were cultured in 5 mM compared with 25 mM D-glucose. Similar findings were found for NDST 2 (Figure 3Go). Our data therefore demonstrate that the regulation of NDST 1 and 2 under hyperglycaemic conditions is different in MC and skin fibroblasts.



View larger version (12K):
[in this window]
[in a new window]
 
Fig. 3.  Influence of glucose on NDST 1 and 2 mRNA expression in MC. The expression of NDST 2 in MC (n=8) that were either cultured in 5 mM (closed circles) or 25 mM D-glucose (open circles) was studied. Results are expressed as NDST 2/GSPDH ratio. No significant differences in NDST 2/GSPDH ratio between 5 and 25 mM D-glucose were found when analysed by Student's t-test for paired samples.

 



   Discussion
 Top
 Abstract
 Introduction
 Subjects and methods
 Results
 Discussion
 References
 
In DN, GBM thickening and MC expansion occur. A disorder in glomerular cell metabolism is believed to be of importance in this disease. In this respect, HSPG metabolism may play a critical role, since this PG not only contributes directly to the anionic charge of the GBM [4,5], but furthermore may be involved in the regulation of MC proliferation [13,14]. Indeed, a decrease in glomerular HS-GAG expression has been reported by several groups to occur in DN [2,3]. Deckert et al. [10] put forward the hypothesis that an altered HSPG metabolism, due to hyperglycaemia, plays a pivotal pathogenic role in DN and its associated vascular complications. In this hypothesis, also called the Steno hypothesis, it is suggested that a genetic heterogeneity in a key enzyme for sulphation of HSPG, i.e. NDST, would result in an increased vulnerability to high glucose concentrations in a subset of diabetic mellitus patients. To date, three different forms of NDST have been purified and cloned [9,15]. However, the existence of a genetic polymorphism in NDST has thus far not been reported.

In the present study, the Steno hypothesis was tested by making use of skin fibroblasts, isolated from type II diabetic patients with or without nephropathy and from non-diabetic patients. The cells were cultured in the presence of different glucose concentrations to study group-specific differences in the production of GAG and/or in the expression of NDST 1 and 2. Although there were group-specific differences found in the expression of NDST, in that the upregulation of NDST 1 was only seen in the non-diabetic group and the overall expression of NDST 2 was significantly decreased in the diabetic group, skin fibroblasts from patients with micro-albuminuria or proteinuria did not react differently from those of diabetic patients without nephropathy. In a previous study [11], it was demonstrated that the expression of HS-GAG is reduced in the skin basement membrane of diabetic patients with nephropathy, but not in those without nephropathy. These data were compatible, at least in part, with the Steno hypothesis, which predicts that a reduction in HS-GAG in patients with DN is not restricted to the GBM. It should be mentioned, however, that the reduction in HS-GAG in the basement membrane of the skin found in this study was not specific to diabetic patients as it was also observed in non-diabetic patients who were on renal replacement therapy [11]. Our findings point to a different direction compared with the histological study by van der Pijl et al. [11]. This discrepancy may be explained as follows. Firstly, in the study by van der Pijl et al. [11], patients with type I diabetes were studied, who may be different from the patients we have studied with type II diabetes. Secondly, although skin fibroblasts produce a large amount of HSPG, it is unclear what proportion of the basement membrane is produced by these cells. Keratinocytes could play a more prominent role in the formation of the skin basement membrane than fibroblasts. Thirdly, fibroblasts may behave differently in vitro and in vivo.

In our study there was a significant inhibition in the incorporation of [3H]glucosamine into GAG in skin fibroblasts that were cultured in the presence of 25 mM D-glucose. It is not clear, however, whether the reduction in [3H]glucosamine incorporation reflects a true inhibition of GAG synthesis. It has been demonstrated by Silbert et al. [16] that the incubation of cells with high glucose concentrations results in the intracellular accumulation of glucosamine, which could compete with the [3H]glucosamine, thereby reducing the incorporation of the radio-label into the GAG. There was no decrease in [35S]sulphate incorporation into the GAG chains, suggesting indeed, that 25 mM D-glucose might not have influenced GAG production in skin fibroblasts. Similar findings have been reported by Deckert et al. [17] and Kofoed-Enevoldsen et al. [18]. Although in our study the [35S]sulphate incorporation was not influenced by high glucose concentrations, a significant inhibition of NDST 2 expression by glucose was found. It should be stressed that NDST 1 and 2 are not the only enzymes involved in HSPG sulphation. NDST 3, epimerase and the O-sulphotransferases may also substantially contribute to HSPG sulphation. The regulation of these enzymes by glucose was not investigated in this study. Moreover, it cannot be concluded that a decrease in NDST mRNA expression correlates with a decrease in NDST enzyme activity.

Previously, Kofoed-Enevoldsen et al. [19,20] reported a reduction in NDST activity in streptozotocin-induced diabetic rats. This is compatible with our own findings, demonstrating that 25 mM D-glucose reduced the mRNA expression of NDST 2 in skin fibroblasts. A generalized influence of hyperglycaemia on NDST, as postulated in the Steno hypothesis, was, however, not observed in our study since the reduction in NDST 2 mRNA expression did not occur in MC that were cultured in medium containing 25 mM D-glucose. It therefore seems that NDST expression is regulated differently by high glucose concentrations in different tissues. Interestingly, it was found that the level of NDST 2 mRNA was significantly decreased in skin fibroblasts from diabetic patients. Although the skin fibroblasts were cultured for up to six passages in medium containing normal glucose concentrations, the influence of hyperglycaemia in vivo apparently persisted in these cells in vitro. These data suggest that a hyperglycaemic environment in vivo may have a long-lasting effect on cells cultured in normal glucose concentrations.

In conclusion, our study does not support the Steno hypothesis for two reasons. Firstly, no differences were found in the regulation or expression of NDST 1 and 2 under high glucose conditions in skin fibroblasts from diabetic patients with or without nephropathy. Secondly, it was found that the mRNA expression of NDST was differentially regulated in skin fibroblasts and MC that were cultured in high glucose concentrations. Nevertheless, the possibility cannot be excluded that inhibition of HSPG production or sulphation due to hyperglycaemia may account for the increased risk in cardiovascular mortality and morbidity in diabetic patients with micro-albuminuria. If this is true, our data at least demonstrate that alterations in HSPG metabolism in diabetic patients with nephropathy are not mediated by generalized differences in the expression and regulation of NDST 1 and 2 mRNA, or by generalized differences in overall GAG synthesis. In all diabetic patients a persisting decrease in NDST 2 mRNA could be observed.



   Notes
 
Correspondence and offprint requests to: Dr B. A. Yard, V. Medizinische Universitätsklinik, Klinikum Mannheim, University of Heidelberg, Theodor-Kutzer-Ufer 1–3, 68135 Mannheim, Germany. Email: benito.yard{at}med5.ma.uni\|[hyphen]\|heidelberg.de Back



   References
 Top
 Abstract
 Introduction
 Subjects and methods
 Results
 Discussion
 References
 

  1. Parving H-H, Osterby R, Anderson PW, Hsueh WA. Diabetic nephropathy. In: Brenner BM, ed. Brenner and Rector's the Kidney (5th edition). Saunders WB, Philidelphia, 1996; 1864–1892
  2. Vernier RL, Steffes MW, Sisson-Ross S, Mauer SM. Heparan sulfate proteoglycan in the glomerular basement membrane in type I diabetes mellitus. Kidney Int1992; 41: 1070–1080[Web of Science][Medline]
  3. Tamsma JT, van der Born J, Bruijn JA et al. Expression of glomerular extracellular matrix components in human diabetic nephropathy: decrease of heparan sulfate in the glomerular basement membrane. Diabetologia1994; 37: 313–320[Web of Science][Medline]
  4. Van den Born J, van den Heuvel PWJ, Bakker MAH, Veerkamp JH, Assmann KJM, Berden JHM. A monoclonal antibody against GBM heparan sulfate induces an acute selective proteinuria in rats. Kidney Int1992; 41: 115–123[Web of Science][Medline]
  5. Kanwar YS, Linker A, Farquhar MG. Increased permeability of the glomerular basement membrane to ferritin after removal of glycosaminoglycans (heparansulfate) by enzyme digestion. J Cell Biol1980; 86: 688–693[Abstract/Free Full Text]
  6. Iozzo RV. Matrix proteoglycans: From molecular design to cellular function. Annu Rev Biochem1998; 67: 609–652[Web of Science][Medline]
  7. Halfer W, Dong S, Schurer B, Cole GJ. Collagen XVIII is a basement membrane heparan sulfate proteoglycan. J Biol Chem1998; 273: 25404–25412[Abstract/Free Full Text]
  8. Rosenberg RD, Shworak NW, Liu J, Schwartz JJ, Zhang LJ. Heparan sulfate proteoglycans of the cardiovascular system. J Clin Invest1997; 99: 2062–2070[Web of Science][Medline]
  9. Kusche-Gullberg M, Erikson I, Pikas DS, Kjellen L. Identification and expression of two heparan sulfate glucosaminyl N-deacetylase/N-sulfotransferase genes. J Biol Chem1998; 273: 11902–11907[Abstract/Free Full Text]
  10. Deckert T, Feldt-Rasmussen B, Borch-Johnsen K, Kofoed-Enevoldsen A. Albuminuria reflects widespread vascular damage. The Steno Hypothesis. Diabetologia1998; 32: 219–226
  11. van der Pijl JW, Daha MR, van den Born J et al. Extracellular matrix in human diabetic nephropathy: reduced expression of heparan sulfate in skin basement membrane. Diabetologia1998; 41: 791–798[Medline]
  12. Douglas MS, Rix DA, Dark JH, Talbo D, Kirby JA. Examination of the mechanism by which heparin antagonizes activation of a model endothelium by interferon-gamma (IFN-{gamma}). Clin Exp Immunol1997; 107: 578–584[Web of Science][Medline]
  13. Aviezer D, Hecht D, Safran M, Eisinger M, David G, Yayon A. Perlecan, basal lamina proteoglycan, promotes basic fibroblast growth factor-receptor binding, mitogenesis and angiogenesis. Cell1994; 79: 1005–1013[Web of Science][Medline]
  14. Aviezer D, Levy E, Safran M et al. Differential structural requirements of heparin and heparan sulfate proteoglycans that promote binding of basic fibroblast growth factor to its receptor. J Biol Chem1994; 269: 114–121[Abstract/Free Full Text]
  15. Aikawa JI, Esko JD. Molecular cloning and expression of a third member of the heparan sulfate/heparin GlcNAc N-deacetylase/N-sulfotransferase family. J Biol Chem1999; 274: 2690–2695[Abstract/Free Full Text]
  16. Silbert CK, Palmer ME, Humphries DE, Silbert JE. Production of [3H]-hexosamine-labeled proteoglycans by cultures of normal and diabetic skin fibroblasts: dilution of exogenous [3H]-glucosamine by endogenous hexosamine from glucose and other sources. Arch Biochem Biophys1989; 268: 393–397[Medline]
  17. Deckert T, Horowitz IM, Kofoed-Enevoldsen A et al. Possible genetic defects in regulation of glycosaminoglycans in patients with diabetic nephropathy. Diabetes1991; 40: 764–770[Abstract]
  18. Kofoed-Enevoldsen A, Petersen JS, Deckert T. Glucosaminyl N-deacetylase in cultured fibroblasts: comparison of patients with and without diabetic nephropathy, and identification of a possible mechanism for diabetes-induced N-deacetylase inhibition. Diabetologia1993; 36: 536–540[Medline]
  19. Kofoed-Enevoldsen A, Noonan D, Deckert T. Diabetes mellitus induced inhibition of glucosaminyl N-deacetylase: effect of short term blood glucose control in diabetic rats. Diabetologia1993; 36: 310–315[Web of Science][Medline]
  20. Kofoed-Enevoldsen A. Inhibition of glomerular glucosaminyl N-deacetylase in diabetic rats. Kidney Int1992; 41: 763–767[Web of Science][Medline]
Received for publication: 8. 2.01
Revision received 9.10.01.
Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
J. van den Born, B. Pisa, M. A. H. Bakker, J. W. A. M. Celie, C. Straatman, S. Thomas, G. C. Viberti, L. Kjellen, and J. H. M. Berden
No Change in Glomerular Heparan Sulfate Structure in Early Human and Experimental Diabetic Nephropathy
J. Biol. Chem., October 6, 2006; 281(40): 29606 - 29613.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
K. J. Williams, M.-L. Liu, Y. Zhu, X. Xu, W. R. Davidson, P. McCue, and K. Sharma
Loss of Heparan N-Sulfotransferase in Diabetic Liver: Role of Angiotensin II
Diabetes, April 1, 2005; 54(4): 1116 - 1122.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (4)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Yard, B.
Right arrow Articles by van der Woude, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yard, B.
Right arrow Articles by van der Woude, F.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?