Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (35)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Yard, B. A.
Right arrow Articles by van der Woude, F. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yard, B. A.
Right arrow Articles by van der Woude, F. J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Nephrol Dial Transplant (2001) 16: 1769-1775
© 2001 European Renal Association-European Dialysis and Transplant Association

Regulation of endothelin-1 and transforming growth factor-ß1 production in cultured proximal tubular cells by albumin and heparan sulphate glycosaminoglycans

Benito A. Yard1,, Emmanuel Chorianopoulos1, Dieter Herr2 and Fokko J. van der Woude1

1 V Medizinische Klinik, Klinikum Mannheim, University of Heidelberg and 2 Knoll AG, Ludwigshafen, Germany



   Abstract
 Top
 Abstract
 Introduction
 Subjects and methods
 Results
 Discussion
 References
 
Background. Both endothelin-1 (ET-1) and transforming growth factor beta 1 (TGF-ß1) have been implicated in the progression of interstitial fibrosis. In the present study we enquired if albumin influences the production of these factors in cultured human proximal tubular epithelial cells (PTEC) and if heparan sulphate glycosaminoglycans (HS-GAG) can inhibit this production.

Methods. ET-1 and TGF-ß1 production in supernatants of PTEC was measured by RIA and ELISA respectively. In addition semi-quantitative reverse transcription polymerase chain reaction (RT-PCR) was performed to study differences in ET-1 and TGF-ß1 mRNA expression. To demonstrate ET-1 or TGF-ß1 binding to heparin or HS-GAG, binding studies by means of dot blot analysis were carried out.

Results. TGF-ß1 and ET-1 were both produced in different concentrations, depending on the PTEC culture tested. Human serum albumin (HSA) up-regulated the production of both factors in a time and dose dependent fashion. The production of these factors was inhibited by heparin under basal and stimulatory conditions. ET-1 production was only inhibited by HS-GAG with a high degree of sulphation. For the inhibition of TGF-ß1 production, the sulphation of HS-GAG was less critical. TGF-ß1, but not ET-1 mRNA expression was inhibited by HS-GAG. Inhibition of sulphation of cell surface HS-GAG resulted in the inhibition of ET-1 but not TGF-ß1 production. Both factors were able to bind to HS-GAG, although this required different amounts of HS-GAG sulphation for each factor.

Conclusions. Our data demonstrate that in PTEC the release of pro-fibrogenic factors can be inhibited by HS-GAG. This may explain to some extent the beneficial effect of heparin in the treatment of interstitial fibrosis.

Keywords: albumin; endothelin-1; heparan sulphate glycosaminoglycans; human proximal tubular epithelial cells; interstitial fibrosis; transforming growth factor ß1



   Introduction
 Top
 Abstract
 Introduction
 Subjects and methods
 Results
 Discussion
 References
 
Interstitial fibrosis is known to be of major importance in deterioration of renal function. The strong relationship to proteinuria suggests a role for filtered proteins in the development of this condition [1]. Among the many mediators that may be involved in this process, endothelins and TGF-ß are of interest [2]. Endothelins were first identified in supernatants of endothelial cells [3] and subsequently it was demonstrated that a variety of non-endothelial cells, including renal cells [4], synthesize endothelins. This family of peptides exerts the most potent vasoconstrictive activity currently known. Besides their vasoconstrictive activity, they display potential proinflammatory and mitogenic actions [5,6]. Endothelins may participate in the regulation of extracellular matrix production. Moreover, ET-1 transgenic mice develop interstitial fibrosis without hypertension [7]. In addition to ET, TGF-ß is a prominent factor in the process of interstitial fibrosis. It modulates the expression of extracellular matrix (ECM) in several renal cell systems in vitro and is considered a determinant of ECM accumulation in tubulointerstitial fibrosis in vivo [8,9].

The progression of interstitial fibrosis may be perpetuated by filtered proteins through activation of tubular cells. Indeed, it has been demonstrated that serum proteins are able to upregulate or induce the production of humoral factors that are involved in fibrotic processes [10]. Beneficial effects of heparin in the treatment of proliferative kidney diseases have been suggested in experimental animals and man [11,12]. The effect of heparin has been considered to be mediated by its multiple anti-inflammatory and anti-proliferative actions such as binding and influencing the bioactivity of several humoral factors, e.g. bFGF. Alternatively, its effect may be explained by compensating the loss of endogenously produced heparan sulphate proteoglycans in the glomerular basement membrane and thereby inhibiting mesangial cell proliferation [12].

In the present paper we investigated the production of two pro-fibrogenic factors, i.e. ET-1 and TGF-ß1, in cultured human proximal tubular epithelial cells (PTEC). To understand the role of serum proteins in the progression of interstitial fibrosis and to understand the beneficial effect of heparin in the treatment of proliferative kidney diseases, the influence of human serum albumin (HSA) and heparan sulphate glycosaminoglycans (HS-GAG) on the production hereof was tested.



   Subjects and methods
 Top
 Abstract
 Introduction
 Subjects and methods
 Results
 Discussion
 References
 
Reagents
The following reagents were used in this study: low-molecular-weight heparin, Dalteparin (Upjohn GmbH, Erlangen, Germany), heparan sulphate glycosaminoglycans (HS-GAG, Table 1Go) (Knoll AG, Ludwigshafen am Rhein, Germany), human serum albumin (HSA), insulin, transferrin, selenium, hydrocortisone, tri-iodothyronine, epidermal growth factor, bovine collagen, trypsin/EDTA (all from Sigma, St Louis, MO, USA). Phosphate-buffered saline (PBS), fetal calf serum (FCS), Dulbecco's modified Eagle's medium (DMEM)/Ham's F12 medium, oligo dT, superscript, dNTP, Taq-polymerase (all from GIBCO GmbH, Eggenstein, Germany), U0126, SB203580, staurosporine (all from Alexis, Grünberg, Germany), anti-p-p42/44, anti-p42/44 (Santa Cruz, Heidelberg, Germany).


View this table:
[in this window]
[in a new window]
 
Table 1. Properties of the different heparins and HS-GAG used in this study

 

Cell culture
Proximal tubular epithelial cells (PTEC) were cultured in serum-free Dulbecco's modified Eagle's medium (DMEM)/Ham's F12 medium in a 1:1 ratio. The medium was supplemented with insulin (5 µg/ml), transferrin (5 µg/ml), selenium (5 µg/ml), hydrocortisone (36 µg/ml), tri-iodothyronine (4 pg/ml) and epidermal growth factor (10 ng/ml). Cells were grown on a matrix of bovine collagen and fetal calf serum (FCS) proteins. The primary cultures were acquired from multiple sources including biopsy tissue pre-transplant, allografts unsuitable for transplantation, and from grossly normal surgical nephrectomy specimens, surgically removed for various reasons. This study was approved by the medical ethics committee of the Faculty of Clinical Medicine at Mannheim, University of Heidelberg.

After outgrowth of the PTEC from explanted cortical remnants, which generally occurred within 7–10 days, cells were washed, trypsinized (0.05%) and subcultured in 25 cm2 or 75 cm2 collagen/FCS coated flasks. Characterization of PTEC was performed by immunofluorescence, using various monoclonal antibodies directed against the epithelial membrane antigen and against the adenosine-deaminase binding protein.

All experiments were performed with confluent monolayers of PTEC seeded in 24-well plates, obtained after the second to fourth subculture. Depending on the specific experiment, the cells were incubated for various periods with one or more of the following substances: Dalteparin, (1–100 IU/ml), glycosaminoglycans 1–8 (0.15 mg/ml), HSA (0.1–10 mg/ml). To inhibit sulphation of cell surface HSPG, PTEC were cultured in sulphate-free medium for 3 days in the presence of various concentrations of NaClO3. Inhibition of sulphation was demonstrated through the incorporation of Na35SO4 and [3H]glucosamine into the HS-GAG chains and subsequent isolation of these chains. All experiment were performed in triplicate and repeated at least three times using either the same or different PTEC. At the end of each experiment, the cell numbers were determined either by microscopic counting or by Coulter counter. A total of 10 different primary cultures were used in this study.

Radioimmunoassay for ET
For quantitative measurements of ET-1, a competitive protein binding radioimmunoassay was used (Nichols Institute Diagnostics, CA, USA). C18 extraction columns were pre-treated sequentially with 5 ml 100% methanol, 5 ml distilled water, and 5 ml of 4% glacial acetic acid. Supernatants were acidified with 3 ml of 4% glacial acetic acid and loaded on the columns. The column was eluted with a 4% glacial acetic acid 86% ethanol mixture. Eluates were evaporated to dryness in a 37°C water bath and reconstituted with 0.5 ml of assay buffer; 0.2 ml of each sample was incubated with 0.1 ml of [125I]ET-1 and 0.1 ml of rabbit anti-endothelin serum for 18 h at 2–8°C. Thereafter, 0.1 ml of donkey anti-rabbit Ig-coated cellulose was added and incubated for another 20–30 min at room temperature. After addition of 1 ml of distilled water, the samples were centrifuged for 15 min, 4000 r.p.m. Supernatants were decanted and the pellet was measured in a gamma counter. ET-1 concentrations were determined by plotting the counts of each sample against a standard curve with known concentrations of ET-1

ELISA for TGF-ß
TGF-ß1 production was determined by sandwich ELISA, according to the manufacturer's instructions (Immundiagnostik GmbH, Bensheim, Germany). Microtitre plates were coated overnight at 4°C with a monoclonal antibody directed against TGF-ß1. The plates were incubated with blocking buffer containing 1% gelatine in carbonate buffer. In each experiment, serial dilutions of a standard with known concentrations of TGF-ß1 were included to calculate concentrations of TGF-ß1 in the supernatants. All samples were acidified with 1 N HCl to activate latent TGF-ß1 and neutralized again with 1 N NaOH, prior to TGF-ß1 determination. After addition of the samples, the plates were sequentially incubated with polyclonal anti-TGF-ß1 and HRP-conjugated rabbit IgG. After each incubation the plates were extensively washed. Substrate conversion was initiated by the addition of TMB and stopped by H2SO4. The plates were read at 405 nm using an automated ELISA reader.

Dot-blot analysis
Small strips of nitrocellulose were prepared and 10 µl of heparin, low-molecular heparin (Dalteparin), and the various GAGs (all in concentrations of 1 mg/ml) were applied onto the strips. After air drying, the strips were fixed in PBS/5% paraformaldehyde/0.5% cetyl pyridinium chloride for 10 min at room temperature. Hereafter, the strips were incubated with 5% BSA to block non-specific binding of the radiolabelled growth factors. The strips were washed three times with PBS and subsequently incubated with 25 µCi of [125I]ET-1 or [125I]TGF-ß1 (NEN, Life Sciences, Boston, MA, USA) for 1 h at 4°C. Thereafter the strips were washed three times with PBS and the blots were exposed to Kodak XS-1 film.

RT-PCR
Fifty nanograms of total RNA isolated from PTEC were reverse transcribed into cDNA by oligo-dT priming. Deoxy-oligonucleotide primers were constructed from the published cDNA sequence of ET-1, TGF-ß1, and porphobilinogen deaminase (PBGD). The sequence of the primers were as follows:
ET-1 forward: GCTGTTTGTGGCTTGCCAAGGAGC
ET-1 reverse: TGCTCGGTTGTGGGTCACATAACG
TGF-ß1 forward: GCCAGTGGTTGAGCCGTGGA
TGF-ß1 reverse: TGTTGGACAGCTGCTCCACCT
PBGD forward: TCTGGTAACGGCAATGCGGCT
PBGD reverse: CCAGGGCATGTTCAAGCTCCT

Two microlitres of cDNA, 50 pmol of each primer, and 0.5 pmol Taq-DNA-polymerase were added to a final volume of 50 µl (50 mmol/l KCl, 10 mmol/l Tris–HCl pH 8.32, 2 mmol/l MgCl2, 2 mg/ml BSA, 0.25 mmol/l of each dNTP). The mixture was heated at 95°C for 5 min followed by 30 cycles, each consisting of incubation for 2.5 min at 95°C, 1.5 min at 55°C, and 1.0 min at 72°C. After termination of the last cycle the samples were chilled at 4°C. Quantification of PCR-products was performed by serial dilutions of cDNA and standardized for equal expression of the PBGD PCR-product.

SDS–PAGE and immunoblotting
To demonstrate activation of p42/44, Western blot analysis of protein-extracts from resting PTEC that were stimulated or not with HSA (10 mg/ml) in the absence or presence of Dalteparin (10 IU/ml) was performed. Twenty micrograms of protein were subjected to SDS–PAGE, using a 10% polyacrylamide gel (Sigma) followed by immunoblotting. Nitrocellulose filters were stained for activated p42/44 (p-p42/44) using a specific monoclonal antibody that only reacts with the activated form of p42/44 in a two-step procedure with a peroxidase-conjugated rabbit anti-mouse IgG as secondary antibody. Detection of p-p42/44 was performed by chemiluminescence. Thereafter the filters were stripped and re-probed with an antibody that reacts with p42/44 irrespective of its activation.

Statistical analysis
Statistical analysis of our data was performed by using the Mann–Whitney test. Statistical significance was defined as P<0.05.



   Results
 Top
 Abstract
 Introduction
 Subjects and methods
 Results
 Discussion
 References
 
Up-regulation of ET-1 and TGF-ß1 production by albumin
Cultured human PTEC produce various amounts of ET-1 and TGF-ß1 under basal conditions. In some cultures the production of ET-1 was higher than that of TGF-ß1, while in other cultures the reverse was found (Table 2Go). The amount produced for both factors was dependent on the PTEC line, but did not depend on the passage number of the cells. Comparable amounts of ET-1 and TGF-ß1 were produced when the same cultures were tested at different times in different passages. No differences in the production were found when the cells were grown in normal culture medium without addition of growth factors (data not shown).


View this table:
[in this window]
[in a new window]
 
Table 2. Basal ET-1 and TGF-ß1 production by cultured human PTEC

 
It is well accepted that proteinuria is a strong predictor for the development of chronic renal failure in many kidney diseases. To test if serum albumin is able to influence ET-1 and TGF-ß1 secretion, human PTEC were cultured in the presence of various concentrations of HSA ranging from 0.1 to 10 mg/ml. The expression of both ET-1 and TGF-ß1 protein (Figure 1Go) and mRNA (data not shown) was up-regulated by HSA in a dose-dependent fashion.



View larger version (13K):
[in this window]
[in a new window]
 
Fig. 1. Up-regulation of ET-1 and TGF-ß1 production in PTEC by HSA. Confluent monolayers of PTEC were either unstimulated or stimulated with various concentrations of HSA. Supernatants were harvested 24 h after stimulation and assessed for the production of ET-1 (open bars) and TGF-ß1 (closed bars). The result of a representative experiment is depicted in which the data are expressed as mean production of triplicate cultures±SD. *P<0.05, **P<0.01, both compared with medium without HSA (0 mg/ml).

 

Influence of heparin and HS-GAG on ET-1 and TGF-ß1 production
Since both ET-1 and TGF-ß1 are produced by cultured PTEC, we investigated if heparin and HS-GAG could influence the production of these factors. In supernatants of PTEC, cultured in the presence of low-molecular-weight (LMW) heparin (Dalteparin), a significant decrease in ET-1 and TGF-ß1 production was detected. Whereas the production of ET-1 was completely inhibited by a high concentration of Dalteparin, the production of TGF-ß1 was already inhibited with low concentrations but was not abrogated even when higher concentrations were used (Figure 2Go). HSA-mediated upregulation in the production of both factors was also inhibited by Dalteparin. In the presence of Dalteparin, a significant inhibition in ET-1 production was observed only after 48 h of HSA stimulation. In contrast, HSA-mediated TGF-ß1 production was already diminished after 24 h (data not shown). LMW and unfractionated heparin gave similar results (data not shown), suggesting that the inhibitory effect of heparin on ET-1 and TGF-ß1 production was not dependent on the molecular weight of heparin. To investigate if the inhibitory effect of heparin was sulphation dependent, different HS-GAG with various degree of sulphation (Table 1Go) were tested for their ability to inhibit ET-1 and TGF-ß1 production. HS-GAG that contained a low content of sulphate, i.e. (GAG 1–5), did not influence the production of ET-1, while it was strongly inhibited by HS-GAG, having a high degree of sulphation (GAG 6–8) (Figure 3AGo). In contrast, a significant inhibition in TGF-ß1 production also occurred when some, HS-GAG with a low sulphate content (GAG 3–5) were used. The inhibitory effect however, was much more pronounced when HS-GAG with a high degree of sulphation were used (Figure 3BGo).



View larger version (11K):
[in this window]
[in a new window]
 
Fig. 2. Inhibition of ET-1 and TGF-ß1 production by heparin. Confluent monolayers of PTEC were cultured in the absence or presence of various concentrations of heparin for 24 h. Then the supernatants were harvested to determine ET-1 (open bars) and TGF-ß production (closed bars). The result of a representative experiment is depicted in which the data are expressed as mean production of triplicate cultures±SD. *P<0.05, **P<0.01, both compared to medium without heparin (0 IU/ml).

 


View larger version (20K):
[in this window]
[in a new window]
 
Fig. 3. Influence of HS-GAG on (A) ET-1 and (B) TGF-ß1 production. Confluent monolayers of PTEC were cultured in the absence or presence of various HS-GAG for 24 h. Then the supernatants were harvested to determine ET-1 and TGF-ß1 production. Results are expressed as means of triplicate cultures±SD. A significant inhibition of ET-1 production was achieved with GAG 6, 7 and 8 compared with medium. The production of TGF-ß1 was significantly inhibited by GAG 3, 4, 5, 6, 7 and 8. *P<0.05, **P<0.01, all compared with medium.

 
In order to test if sulphation of cell-bound HSPG is important in the regulation of ET-1 and TGF-ß1 production, PTEC were cultured for 3 days in sulphate-free medium in the presence of NaClO3, a known inhibitor of HSPG sulphation. The incorporation of Na35SO4 in cell-surface HS-GAG was inhibited by NaClO3, in a dose-dependent fashion (data not shown). Interestingly, the production of ET-1, but not TGF-ß1 was strongly inhibited under sulphate-free conditions (Figure 4Go).



View larger version (14K):
[in this window]
[in a new window]
 
Fig. 4. Influence of NaClO3 treatment on ET-1 and TGF-ß1 production. Confluent monolayers of PTEC were cultured for three days in sulphate-free medium in the absence or presence of various concentrations of NaClO3. Then the supernatants were removed and fresh medium with the same concentrations of NaClO3 was added to the cells for another 24 h to measure ET-1 and TGF-ß1 production. Supernatants were harvested and assessed for ET-1 (open bars) and TGF-ß1 (closed bars) production. Results are expressed as means of triplicate cultures±SD. *P<0.05 compared to medium.

 
Analysis of mRNA by means of semi-quantitative RT-PCR revealed that no influence of heparin or HS-GAG was observed on ET-1 mRNA expression. In contrast, a reduction in TGF-ß1 mRNA expression was found in heparin- or GAG-treated PTEC cultures (Figure 5Go). These data thus demonstrate that down-regulation of ET-1 mRNA did not underlie the observed inhibition of ET-1 production found in supernatants of heparin- or HS-GAG-treated PTEC cultures.



View larger version (30K):
[in this window]
[in a new window]
 
Fig. 5. Semi-quantitative RT-PCR. Total RNA was extracted from PTEC that were cultured in normal medium (M) or that had been cultured in the presence of heparin (H), GAG 4 or GAG 7. Serial dilutions of the same cDNA were than amplified for ET-1 and TGF-ß1 as described in materials and methods. To exclude the possibility that differences in ET-1 or TGF-ß1 mRNA expression were due to differences in RNA concentrations, amplification of the same cDNA was also performed for the housekeeping gene PBGD.

 
It has been demonstrated that a variety of humoral factors such as IFN{gamma} and bFGF can bind to HS-GAG [13,14]. We therefore investigated if binding of ET-1 or TGF-ß1 to heparin or HS-GAG was involved in the inhibition of ET-1 and TGF-ß1 production. To this end, binding studies by means of dot-blot analysis were performed. It was found that HS-GAG 1–5 did not bind TGF-ß1, although HS-GAG 3–5 were able to inhibit TGF-ß1 production. Moreover, HS-GAG 1 was able to bind ET-1, although it did not inhibit ET-1 production. HS-GAG 6–8 were able to bind both ET-1 and TGF-ß1 and inhibited the production hereof (Figure 6Go). Binding of ET and TGF-ß1 to HS-GAG therefore may be involved in, but does not exclusively explain, the inhibition of ET-1 and TGF-ß1 production by heparin or HS-GAG.



View larger version (37K):
[in this window]
[in a new window]
 
Fig. 6. Dot-blot analysis. Ten microlitres of each GAG were spotted on nitrocellulose filters and air dried. The filters were incubated with [125I]TGF-ß or [125I]ET-1 and thereafter extensively washed, as described in the Subjects and methods section. H, heparin; ND, not done.

 
Since heparin is able to influence the activation of mitogen activated protein kinases (MAPK), we investigated if pharmacological inhibitors of p42/44 or p38 activation were also able to influence ET-1 and TGF-ß1 production under basal and stimulatory conditions. Moreover, the role of protein kinase C (PKC) activation in the regulation of these factors was addressed. Basal production of TGF-ß1, but not ET-1, was strongly abrogated when PTEC were cultured in the presence of a selective inhibitor of p42/44 activation (U0126). In HSA-stimulated PTEC, however, both TGF-ß1 and ET-1 production were inhibited by U0126. In contrast, neither inhibition of p38 nor PKC, using SB203580 or staurosporine respectively, influenced the production of these factors under basal or stimulatory conditions, even when high concentrations of the inhibitors were used (Table 3Go). Because inhibition of p42/44 activation in resting PTEC by Dalteparin was difficult to test, PTEC were either stimulated or not with 10 mg/ml of HSA in the presence or absence of 10 IU/ml of Dalteparin. A strong activation of p42/44 was observed when PTEC were stimulated with HSA. Although inhibition of basal p42/44 activation by Dalteparin was not detected in this system, Dalteparin significantly inhibited the activation of p42/44 under stimulatory conditions (Figure 7Go).


View this table:
[in this window]
[in a new window]
 
Table 3. Influence of PKC and MAPK inhibitors on ET-1 and TGF-ß1 production

 


View larger version (43K):
[in this window]
[in a new window]
 
Fig. 7. Inhibition of p42/44 activation by Dalteparin. Confluent monolayers of PTEC that were growth-arrested for 3 days were either unstimulated or stimulated with HSA (10 mg/ml) for 4 h in the presence or absence of Dalteparin. Lane 1, unstimulated PTEC; lane 2, HSA-stimulated PTEC; lane 3, unstimulated PTEC cultured with Dalteparin for 4 h; lane 4, HSA-stimulated PTEC cultured with Dalteparin for 4 h.

 



   Discussion
 Top
 Abstract
 Introduction
 Subjects and methods
 Results
 Discussion
 References
 
Since endothelin was first isolated from supernatants of cultured endothelial cells its importance in renal physiology and pathology has become evident [13]. Besides its potent vasoconstrictive effects leading to a decreased renal blood flow and glomerular filtration rate (GFR), ET has recently become of interest as a paracrine and autocrine signalling peptide, especially in the development of renal interstitial fibrosis [15]. It has been suggested that ET-1 may be involved in the pathogenesis of interstitial fibrosis, since ET-1 transgenic mice develop an age-dependent reduction in GFR due to interstitial fibrosis and glomerular sclerosis in the absence of hypertension [7]. Moreover, ET is a chemotactic factor for blood monocytes, and through binding to specific receptors directly increases the secretion of pro-inflammatory cytokines [6,16]. In addition to ET-1, the importance of renal TGF-ß production has been documented in several models of interstitial fibrosis [8,9].

In the present study we report on the production and regulation of ET-1 and TGF-ß1 by cultured human PTEC. Our findings that PTEC constitutively produce both factors and that HSA up-regulates the production is in agreement with earlier reports [10]. These reports have suggested that high protein concentrations in general lead to the activation of tubular cells, thereby stimulating the production of a variety of humoral factors. The strong correlation between proteinuria and tubulointerstitial fibrosis [1] is in agreement with this finding.

Heparin and HS-GAG inhibited the production of ET-1 and TGF-ß1 by human PTEC in a dose-dependent fashion. This effect was independent of the molecular weight of heparin, since low-molecular-weight and unfractionated heparin gave similar results. In contrast, the degree of sulphation was important for the inhibitory effect. One possible explanation for heparin's effect may be related to the binding of ET-1 and TGF-ß to heparin. Dot-blot-analysis revealed that both factors bind to heparin and HS-GAG with high sulphate content. Binding of TGF-ß to heparan sulphate (HS) has also been reported by others [17,18]. It was found that TGF-ß binds to the highly sulphated liver HS, while it could not bind to the low sulphated mucosal HS, compatible with our own findings using HS-GAG with various degrees of sulphation. TGF-ß1, however, did not bind to HS-GAG that were able to inhibit TGF-ß1 production (GAG 3–5). Moreover, ET-1 was able to bind to HS-GAG 1, although this was not accompanied by an inhibition in ET-1 production. It thus seems, that binding itself cannot be the only mechanism involved in the inhibition of ET-1 and TGF-ß1 production by heparin, although it may participate in this process. Another explanation is related to inhibition of p42/44 activation. It was demonstrated that only basal TGF-ß1 production was inhibited by U0126. Compatible with this, it was found that Dalteparin only inhibited basal TGF-ß1 mRNA expression. Although it was not demonstrated in this study that Dalteparin inhibited basal activation of p42/44 in resting PTEC, a clear inhibition was found under stimulatory conditions. Therefore it is likely that Dalteparin exerts its action on ET-1 and TGF-ß1 production both through binding of these factors and through inhibition of p42/44 activation. No influence of p38 or PKC activation on the regulation of ET-1 and TGF-ß1 production was observed in this study.

Interestingly, heparin inhibits ET-1 mRNA expression in endothelial and mesangial cells [19,20]. In our study, however, no changes in ET-1 mRNA expression were observed in PTEC that were treated with heparin. It should be mentioned that the antibodies used in the RIA cross-react with ET-2 and 3. Although ET-1 is the predominant endothelin species expressed in renal tissue, it cannot be excluded that down-regulation of endothelin production was due to a decreased production of ET-2 or 3. The influence of heparin on ET-2 or 3 mRNA expression was not tested in this study.

We conclude from this study that albumin upregulates both ET-1 and TGF-ß production by tubular cells. Whether tubular-derived endothelin or TGF-ß in vivo is a major factor in the progression of interstitial fibrosis is at this point uncertain. Further studies will have to define the relevance of tubular ET-1 and TGF-ß production in the regulation of interstitial fibrosis as well as the possible therapeutic implications of these findings. Heparin and related compounds seem to be promising agents in this respect, since they bind ET-1 and TGF-ß directly and may counteract the pro-fibrogenic effects of intra-tubular proteins in proteinuric patients.



   Acknowledgments
 
This study was supported by a grant of the Deutsche Forschungsgemeinschaft (DFG) and the Forschungsfond Mannheim.



   Notes
 
Correspondence and offprint requests to: Dr B. A. Yard, V Medizinische Universitätsklinik, Klinikum Mannheim, University of Heidelberg, Theodor-Kutzer-Ufer 1–3, D-68135 Mannheim, Germany. Back



   References
 Top
 Abstract
 Introduction
 Subjects and methods
 Results
 Discussion
 References
 

  1. Fine LG, Ong AC, Norman JT. Mechanisms of tubulointerstitial injury in progressive renal disease. Eur J Clin Invest1993; 23: 359–365
  2. Diaz FJ. Vasoactive hormones and renal sclerosis. Kidney Int1996; 49: 578–597[Web of Science][Medline]
  3. Yanagisawa BD, Kurihara H, Kimura S. A novel potent vasoconstrictor peptide produced by vascular endothelial cells. Nature1988; 332: 411–415[Medline]
  4. Wilkes BM, Susin M, Mento PF. Localization of endothelin-like immunoreactivity in rat kidneys. Am J Physiol1991; 260: F913–920[Abstract/Free Full Text]
  5. Battistini B, Chailer P, D'orleans-Juste P, Briere N, Sirois P. Growth regulatory property of endothelins. Peptides1993; 14: 385–399[Web of Science][Medline]
  6. Helset E, Sildnes T, Seljelid R, Konopski ZS. Endothelin-1 stimulates human monocytes in vitro to release TNF-{alpha}, IL-1ß and IL-6. Mediat Inflam1993; 2: 417–422
  7. Hocher B, Thöne-Reineke C, Rohmeis P et al. Endothelin-1 transgenic mice develop glomerulosclerosis, interstitial fibrosis and renal cysts but not hypertension. J Clin Invest1997; 99: 1380–1389[Web of Science][Medline]
  8. Bertelli R, Valenti F, Oleggini R et al. Cell-specific regulation of alpha 1(III) and alpha 2 (V) collagen by TGF-beta1 in tubulointerstitial cell models. Nephrol Dial Transplant1998; 13: 573–579[Abstract/Free Full Text]
  9. Fishberg Y, Kelly CJ. TGF-beta and regulation of interstitial nephritis. Miner Electrolyte Metab1998; 24: 181–189[Web of Science][Medline]
  10. Zoja C, Morigi M, Figliuzzi M et al. Proximal tubular cell synthesis of endothelin 1 in challenge with albumin and other proteins. Am J Kidney Dis1995; 26: 934–941[Web of Science][Medline]
  11. Floege J, Eng E, Young BA, Johnson RJ. Heparin suppresses mesangial cell proliferation and matrix expansion in experimental mesangioproliferative glomerulonephritis. Kidney Int1993; 43: 369–380[Web of Science][Medline]
  12. Van der Woude FJ, van Det N. Heparan sulfate proteoglycans in diabetic nephropathy. Exp Nephrol1997; 5: 180–188[Medline]
  13. Rusnati M, Coltrini D, Caccia P et al. Distinct role of 2-O-, N- and 6-O-sulphate groups of heparin in the formation of the ternary complex with basic fibroblast growth factor and soluble FGF receptor-1. Biochem Biophys Res Commun1994; 203: 450–458[Web of Science][Medline]
  14. Camejo EH, Rosengren B, Camejo G, Sartipy P, Fager G, Bondjers G. IFN-gamma binds to extracellular matrix chondroitin-sulfate proteoglycans, thus enhancing its cellular response. Arterioscler Thromb Vasc Res1995; 15: 1456–1465[Abstract/Free Full Text]
  15. Ong ACM. Tubulointerstitial actions of endothelins in the kidney: roles in health and disease. Nephrol Dial Transplant1996; 11: 251–257[Free Full Text]
  16. Achmad T, Rao G. Chemotaxis of human blood monocytes toward endothelin-1 and the influence of calcium channel blockers. Biochem Biophys Res Commun1992; 189: 994–1000[Web of Science][Medline]
  17. McCaffrey TA, Falcone DJ, Vincente D, Du B, Consigli S, Borth W. Protection of transforming growth factor-beta 1 activity by heparin and fucoidin. J Cell Physiol1994; 159: 51–59[Web of Science][Medline]
  18. Lyon M, Rushton G, Gallagher JT. The interaction of the transforming growth factor-betas with heparin/heparan sulfate is isoform specific. J Biol Chem1997; 272: 18000–18006[Abstract/Free Full Text]
  19. Kohno M, Yokokawa K, Horio T et al. Heparin inhibits endothelin-1 production in rat cultured mesangial cells. Kidney Int1994; 45: 137–142[Web of Science][Medline]
  20. Yokokawa K, Kohno M, Mandal AK, Tahara H, Yanagisawa M, Takeda T. Heparin suppressed endothelin-1 peptide and mRNA expression in cultured endothelial cells of spontaneously hypertensive rats. JASN1994; 4: 1683–1689[Abstract]
Received for publication: 6. 6.00
Revision received 30. 3.01.
Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Nephrol Dial TransplantHome page
M. M. van Timmeren, M.-L. Gross, W. Hanke, P. A. Klok, H. van Goor, C. A. Stegeman, and S. J. L. Bakker
Oleic acid loading does not add to the nephrotoxic effect of albumin in an amphibian and chronic rat model of kidney injury
Nephrol. Dial. Transplant., December 1, 2008; 23(12): 3814 - 3823.
[Abstract] [Full Text] [PDF]


Home page
LupusHome page
G Ferraccioli and G Romano
Renal interstitial cells, proteinuria and progression of lupus nephritis: new frontiers for old factors
Lupus, June 1, 2008; 17(6): 533 - 540.
[Abstract] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
N. Perico, M. Abbate, and G. Remuzzi
More on Renal Disease Progression: Is Interstitial Inflammation Truly Protective?
J. Am. Soc. Nephrol., June 1, 2007; 18(6): 1630 - 1632.
[Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
R. Diwakar, A. L. Pearson, P. Colville-Nash, N. J. Brunskill, and M. E. C. Dockrell
The role played by endocytosis in albumin-induced secretion of TGF-beta1 by proximal tubular epithelial cells
Am J Physiol Renal Physiol, May 1, 2007; 292(5): F1464 - F1470.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
C. Caruso-Neves, A. A. S. Pinheiro, H. Cai, J. Souza-Menezes, and W. B. Guggino
PKB and megalin determine the survival or death of renal proximal tubule cells
PNAS, December 5, 2006; 103(49): 18810 - 18815.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
M. Abbate, C. Zoja, and G. Remuzzi
How Does Proteinuria Cause Progressive Renal Damage?
J. Am. Soc. Nephrol., November 1, 2006; 17(11): 2974 - 2984.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
J. Prakash, M. Sandovici, V. Saluja, M. Lacombe, R. Q. J. Schaapveld, M. H. de Borst, H. van Goor, R. H. Henning, J. H. Proost, F. Moolenaar, et al.
Intracellular Delivery of the p38 Mitogen-Activated Protein Kinase Inhibitor SB202190 [4-(4-Fluorophenyl)-2-(4-hydroxyphenyl)-5-(4-pyridyl)1H-imidazole] in Renal Tubular Cells: A Novel Strategy to Treat Renal Fibrosis
J. Pharmacol. Exp. Ther., October 1, 2006; 319(1): 8 - 19.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
X. Yu, O. A. Ibrahimi, R. Goetz, F. Zhang, S. I. Davis, H. J. Garringer, R. J. Linhardt, D. M. Ornitz, M. Mohammadi, and K. E. White
Analysis of the Biochemical Mechanisms for the Endocrine Actions of Fibroblast Growth Factor-23
Endocrinology, November 1, 2005; 146(11): 4647 - 4656.
[Abstract] [Full Text] [PDF]


Home page
ChestHome page
H. Kubo, K. Nakayama, M. Yanai, T. Suzuki, M. Yamaya, M. Watanabe, and H. Sasaki
Anticoagulant Therapy for Idiopathic Pulmonary Fibrosis
Chest, September 1, 2005; 128(3): 1475 - 1482.
[Abstract] [Full Text] [PDF]


Home page
Nephrol Dial TransplantHome page
G. K. Rangan, Y. Wang, Y.-C. Tay, and D. C.H. Harris
Differential effects of albumin on cytokine gene expression in proximal tubular epithelial cells
Nephrol. Dial. Transplant., May 1, 2005; 20(5): 1013 - 1014.
[Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
P. Biswas, A. Roy, R. Gong, A. Yango, E. Tolbert, J. Centracchio, and L. D. Dworkin
Hepatocyte growth factor induces an endothelin-mediated decline in glomerular filtration rate
Am J Physiol Renal Physiol, January 1, 2005; 288(1): F8 - F15.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
N. J. Brunskill
Albumin Signals the Coming of Age of Proteinuric Nephropathy
J. Am. Soc. Nephrol., February 1, 2004; 15(2): 504 - 505.
[Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
A. Benigni, C. Zoja, D. Corna, C. Zatelli, S. Conti, M. Campana, E. Gagliardini, D. Rottoli, C. Zanchi, M. Abbate, et al.
Add-On Anti-TGF-{beta} Antibody to ACE Inhibitor Arrests Progressive Diabetic Nephropathy in the Rat
J. Am. Soc. Nephrol., July 1, 2003; 14(7): 1816 - 1824.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
C. Zoja, M. Morigi, and G. Remuzzi
Proteinuria and Phenotypic Change of Proximal Tubular Cells
J. Am. Soc. Nephrol., June 1, 2003; 14(90001): S36 - 41.
[Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
C. Zoja, D. Corna, D. Camozzi, D. Cattaneo, D. Rottoli, C. Batani, C. Zanchi, M. Abbate, and G. Remuzzi
How To Fully Protect the Kidney in a Severe Model of Progressive Nephropathy: A Multidrug Approach
J. Am. Soc. Nephrol., December 1, 2002; 13(12): 2898 - 2908.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (35)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Yard, B. A.
Right arrow Articles by van der Woude, F. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yard, B. A.
Right arrow Articles by van der Woude, F. J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?