Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (2)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Tateyama, F.
Right arrow Articles by Okumura, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tateyama, F.
Right arrow Articles by Okumura, K.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Nephrol Dial Transplant (2001) 16: 1149-1155
© 2001 European Renal Association-European Dialysis and Transplant Association

Interleukin-1ß is an autocrine growth factor of rat glomerular epithelial cells in culture

Fumiko Tateyama, Hideaki Yamabe, Hiroshi Osawa, Mitsuaki Kaizuka, Kenichi Shirato and Ken Okumura

Second Department of Internal Medicine, Hirosaki University School of Medicine, Hirosaki, Japan



   Abstract
 Top
 Abstract
 Introduction
 Subjects and methods
 Results
 Discussion
 References
 
Background. The proliferation of glomerular epithelial cells (GEC) is usually observed in crescentic glomerulonephritis. However, the regulation of GEC proliferation is not fully understood. Although it is known that interleukin-1ß (IL-1ß) has a mitogenic effect on mesangial cells and is produced by mesangial cells, the effect of this cytokine on GEC proliferation is not known. We investigated whether cultured rat GEC could produce IL-1ß, and the role of IL-1ß on GEC proliferation.

Methods. Cultured rat GEC from 24th to 36th passage were used. GEC proliferation was evaluated with a colorimetric assay using the tetrazolium salt. GEC were incubated in K1 medium for 72 h and IL-1ß in the culture supernatants was measured by specific enzyme-linked immunosorbent assay (ELISA). IL-1ß in GEC supernatants was examined by immunoblot analysis. IL-1ß mRNA expression in GEC was examined by reverse transcription-polymerase chain reaction (RT-PCR).

Results. IL-1ß showed a mitogenic effect on GEC, while interferon-{gamma} (IFN-{gamma}) and heparin inhibited GEC proliferation. Moreover, GEC proliferation cultured with K1 medium was partially inhibited by anti-IL-1ß neutralizing antibody. Amounts of IL-1ß in the culture supernatants increased over time (24–72 h). K1 medium increased IL-1ß production by GEC, while IFN-{gamma} or heparin did not change IL-1ß production. Immunoblot analysis revealed 17 kD protein of IL-1ß in the concentrated GEC supernatants. RT-PCR also demonstrated mRNA expression of IL-1ß in GEC.

Conclusions. Our data indicate that IL-1ß is an autocrine growth factor for GEC and may have an important role in the regulation of GEC proliferation.

Keywords: IL-1ß; IFN-{gamma}; heparin; GEC



   Introduction
 Top
 Abstract
 Introduction
 Subjects and methods
 Results
 Discussion
 References
 
In many forms of glomerulonephritis, hypercellularity and matrix accumulation in the glomerulus are frequently observed. These histological changes have a prognostic significance. For the local changes in the glomerulus, both inflammatory cells infiltrated from the circulation into the glomeruli and intrinsic glomerular cells appear to play major roles by secreting cytokines and various growth factors [1,2].

Glomerular epithelial cells (GEC) play a crucial role in maintaining permselectivity in vivo. Recent in vitro studies including our own studies have shown that GEC are capable of secreting factors which may mediate glomerular injury such as tissue factors [3], monocyte chemotactic factors [4], interleukin 6 (IL-6) [5], transforming growth factorß (TGF-ß) [6], platelet-derived growth factor (PDGF) [7], extracellular matrix, and matrix degrading proteinases [8].

Proliferation of parietal and possibly visceral GEC may occur in some forms of glomerular injury including focal segmental sclerosis and crescentic glomerulonephritis. It is generally accepted that glomerular crescent plays an important role in progressive glomerular injury and it consists of proliferating cells including epithelial cells and macrophages, deposited fibrin, and extracellular matrix. However, the regulation of GEC proliferation is not fully understood. Although it is known that interleukin-1ß (IL-1ß) has a mitogenic effect on mesangial cells and it is produced by mesangial cells [9], the effect of this cytokine on GEC proliferation is not known. We investigated whether cultured rat GEC could produce IL-1ß and its role in GEC proliferation. We also investigated the effects of interferon-{gamma} (IFN-{gamma}) and heparin, which are known to inhibit mesangial cell proliferation, on GEC proliferation and IL-1{gamma} production by GEC.



   Subjects and methods
 Top
 Abstract
 Introduction
 Subjects and methods
 Results
 Discussion
 References
 
GEC culture
GEC culture was established by a modification of the method of Harper et al. [10]. Glomeruli were isolated from the kidneys of male Sprague-Dawley rats weighing 60–80 g (Charles River Japan, Inc, Tokyo, Japan) with stainless steel sieves. Decapsulated glomeruli were placed on Vitrogen 100 gel (Collagen Corporation, Palo Alto, CA), which is type 1 collagen derived from cattle skin. The glomeruli were nourished with K1-3T3 medium, which is a 1:1 mixture of K1 medium and conditioned medium of Swiss mouse 3T3 fibroblasts (American Type Culture Collection, Rockville, MD). K-1 medium is a 1:1 preparation of Dulbecco's modified eagle's minimum essential medium (DMEM, Gibco Laboratories, Grand Island, NY) and Ham's nutrient mixture F-12 (Gibco) containing 2% Nu-Serum (Collaborative Research, Bedford, MA), and ITS premix (I, insulin; T, transferin; S, serenium; Collaborative Research). Nu-Serum is an advanced, low-protein, cell growth medium supplement including epidermal growth factor, triiodothyronine, progesterone, estradiol, testosterone, hydrocortisone etc. When GEC grew up from the glomeruli, GEC were picked up and subcultured. The cells between 24th and 36th passage were used for the study.

Characterization of cultured GEC
The cells used in this study satisfied previously reported criteria as GEC [11]. They showed cobblestone appearance under phase-contrast microscopic examination. In immunofluorescence studies, they were positive for cytokeratin and FX1A. In addition, neither markers for mesangial cells (Thy1.1) nor endothelial cells (Factor VIII-related antigen) were detected in these cells. They also had susceptibility to low doses (10–100 µg/ml) of aminonucleoside puromycin (Sigma, St Louis, MO). At present, it is not possible to determine specifically whether GEC in culture originate from visceral or parietal epithelium.

Evaluation of GEC proliferation
Proliferation of GEC was evaluated by MTT (3-(4,5-dimethylthiazol-2-yl)-diphenyl tetrazolium bromide) assay as described before [8]. GEC were plated in wells of 96-well plates (Falcon, Becton Dickinson, Franklin Lakes, NJ) at a density of 5000 cells/well. After overnight incubation with K1 medium, the cells were washed twice with Hanks balanced salt solution (HBSS, Gibco). The cells were incubated for 48 h under various experimental conditions. During the last 1.5 h, 20 µl MTT solution (Promega, Madison, WI) was added. Then optical density (OD) at 490 nm with a reference of 650 nm was measured by an enzyme-linked immunosorbent assay (ELISA) reader.

Effects of IL-1ß, IFN-{gamma}, and heparin on GEC proliferation
To examine the stimulatory effect of IL-1ß on GEC proliferation, GEC were incubated in Nu-Serum-free K1 medium with 0.2% bovine serum albumin (BSA, Sigma) containing various concentrations of recombinant rat IL-1ß (0.5, 5.0, 50.0, 500.0 pg/ml, R&D Systems Inc., Minneapolis, MN) for 48 h. GEC were incubated in Nu-Serum-free K1 medium with 50.0 pg/ml IL-1ß containing various concentrations of recombinant rat IFN-{gamma} (0.1, 1.0, 10.0 ng/ml, Pepro Tech Inc, Rocky Hill, NJ) or heparin (0.1, 1.0, 10.0 U/ml, Mochida Pharmaceutical Co, Tokyo, Japan) for 48 h in order to evaluate the inhibitory effect of these factors against IL-1ß. GEC were also incubated in K1 medium containing various concentrations of IFN-{gamma} (0.1, 1.0, 10.0 ng/ml) or heparin (0.1, 1.0, 10.0 U/ml) for 48 h in order to examine the inhibitory effect of these factors against K1 medium especially Nu-Serum. Then GEC proliferation was evaluated by using MTT method. The cytotoxicity of IL-1ß, IFN-{gamma} or heparin was evaluated by assessing the release of lactate dehydrogenase (LDH) from GEC. GEC were incubated in 24-well plates (Falcon, Becton Dickinson) with IL-1ß (0.5, 5.0, 50.0, 500.0 pg/ml), IFN-{gamma} (0.1, 1.0, 10.0 ng/ml), or heparin (0.1, 1.0, 10.0 U/ml) for 72 h and the amount of LDH in the cell supernatants was measured. After removing the cell supernatants, GEC were lysed by mellitin (50 µg/ml, Sigma) and the amount of LDH in the cells was also measured. LDH was quantified by a colorimetric method using LDH assay kit (Sanassay LDH, Sankou Junyaku Inc. Tokyo, Japan).

Effect of anti-IL-1ß antibody on GEC proliferation
We examined the effect of anti-rat IL-1ß neutralizing antibody (R&D Systems Inc.), which is polyclonal goat IgG, on GEC proliferation. GEC were incubated for 48 h in Nu-Serum-free K1 medium with 0.2% BSA, K1 medium only, K1 medium plus 20 µg/ml anti-IL-1ß antibody, and K1 medium plus 20 µg/ml normal goat IgG (Organon Teknika Corporation, West Chester, PA). Then GEC proliferation was evaluated by MTT assay.

IL-1ß assay
IL-1ß was assayed by using a commercially available ELISA kit (Bio Source International, Camarillo, CA), according to the manufacture's instructions. This assay was a sandwich ELISA using antibody specific for IL-1ß and an enzyme-linked antibody for IL-1ß. This assay recognized both natural rat IL-1ß and recombinant rat IL-1ß. No significant cross-reactivity with other cytokines was observed. The sensitivity and the limit of the assay were 3 pg/ml and 2000 pg/ml, respectively.

IL-1ß production by GEC
GEC were cultured in 12-well plates (Falcon, Becton Dickinson) and were grown to confluence. Subsequently, the cells were washed with Hank's balanced salt solution and incubated in Nu-Serum-free K1 medium with 0.2% BSA or K1 medium for 24, 48, or 72 h. Then the amount of IL-1ß in the cell supernatants was measured by ELISA. The cells in each well were lysed in 1 N NaOH and the protein content was measured by the method of Lowry et al. [12] using BSA as a standard. The levels of IL-1ß in culture supernatants were expressed as ng per µg of lysed GEC protein. We also measured IL-1ß in the supernatants of GEC incubated with rat IFN-{gamma} (0.1–10.0 ng/ml) or heparin (0.1–10.0 U/ml) for 72 h.

Immunoblot analysis of IL-1ß of GEC
Concentrated GEC conditioned media were reduced by boiling in the presence of sodium dodecyl sulphate (SDS) and 2-mercaptoethanol. The reduced samples were electrophoresed on 12% SDS-polyacrylamide gel and electrophoretically transferred to a nitrocellulose membrane (Bio-Rad Laboratories, Richmond, CA). Immunoblot analysis was performed using Amplified Alkaline Phosphatase Immuno-Blot Assay Kit (Bio-Rad Laboratories). Polyclonal anti-rat IL-1ß antibody (0.2 µg/ml) (R&D Systems Inc.) was used as first antibody and biotinylated anti-goat IgG (0.16 µg/ml) (EY Laboratories Inc., San Mateo, CA) was used as second antibody.

Detection of IL-1ß mRNA in GEC
IL-1ß mRNA expression in GEC was examined by reverse transcription-polymerase chain reaction (RT-PCR). Total RNA was extracted from cultured GEC with K1 medium by one step method using RNA zol (Cinna Biotex, Houston, TX). Total RNA was further purified using poly A+RNA by oligo (dT) 30-Latex (Takara Biochemicals, Kyoto, Japan) as reported previously [5].

Reverse transcription was carried out using a first strand synthesis kit (Stratagene, La Jolla, CA) to obtain cDNA. One µg of poly A+RNA in 32 µl solution was mixed with 300 ng oligo dT primer and then heated at 65°C for 5 min. After cooling at room temperature, 5 mM DTT, 4 U RNase inhibitor, 250 µM dNTPs and 20 U Moloney murine leukaemia virus reverse transcriptase were added and the mixture was incubated at 37°C for 60 min. The reaction was stopped by placing the reaction tubes on ice.

Three µl of cDNA solution was mixed with 5 µl reaction buffer (500 mM KCL, 100 mM Tris-HCl pH 8.3, 15 mM MgCl and 0.001% gelatine), 4 µl dNTP mix (final concentration was 200 µM of dATP, dCTP, dGTP and dTTP), 2.5 µl of sense and antisense primer (final concentrarion; 50 pM), 34 µl sterile water and 0.5 µl Taq DNA polymerase (2.5 units). Both sense and antisense primers were designed as described previously [13]. Sequence of sense primer was; 5'- CTCTGTGACTCGTGGGATGATGAC3' (bases 372–395). Antisense primer was; 5'-TCTTCTTCTTTGGGTATTGTTTGG3' (bases 673–696). The predicted size of the amplified product was 325 bp. Thirty eight cycles of amplification was carried out in the DNA thermal cycler (Parkin/Elmer Cetus, Norwak, CT) with denaturing for 45 s at 94°C, annealing for 45 s at 57°C and extension for 45 s at 72°C. Twenty five µl of the PCR product was electrophoresed on a 2% agarose gel with size markers ({phi}X174/HincII digest, Nippon gene, Tokyo, Japan). For visualization, gel was stained with ethidium bromide and photographed on a UV transilluminator (Funakoshi, Tokyo, Japan).

Statistical analysis
All data were expressed as mean±one standard deviation. Results were compared using one-way factorial ANOVA and multiple comparison tests, and two-way repeated-measures ANOVA. IL-1ß production by GEC in the presence or absence of Nu-Serum was compared using two-way ANOVA. P<0.05 was considered to be significant.



   Results
 Top
 Abstract
 Introduction
 Subjects and methods
 Results
 Discussion
 References
 
Effects of IL-1ß, IFN-{gamma} and heparin on GEC proliferation
IL-1ß (5.0–500.0 pg/ml) significantly promoted the proliferation of GEC cultured with Nu-Serum-free K1 medium in a dose-dependent manner (Figure 1Go). INF-{gamma} (10.0 ng/ml) and heparin (0.1–10.0 U/ml) inhibited IL-1ß-stimulated GEC proliferation (Figure 2Go). K1 medium including Nu-Serum significantly promoted GEC proliferation and INF-{gamma} (1.0, 10.0 ng/ml) inhibited this Nu-Serum-stimulated GEC proliferation in a dose-dependent manner (Figure 3AGo). Heparin (0.1–10.0 U/ml) also inhibited Nu-Serum-stimulated GEC proliferation in a dose-dependent manner (Figure 3BGo). There was no significant LDH release from GEC treated with IL-1ß, IFN-{gamma}, or heparin, indicating that no cytotoxicity was observed by any of the agents used.



View larger version (13K):
[in this window]
[in a new window]
 
Fig. 1. Effect of recombinant rat IL-1ß (0.5–500.0 pg/ml) on GEC proliferation was evaluated using a MTT method. IL-1ß (5.0–500.0 pg/ml) significantly promoted GEC proliferation in a dose-dependent manner. Values are the mean±SD for six wells, and representative data from one of three experiments are shown. *P<0.01 vs 0 pg/ml IL-1ß, P<0.05 vs 0.5 pg/ml IL-1ß, **P<0.005 vs 0 pg/ml IL-1ß, P<0.01 vs 0.5 pg/ml IL-1ß, ***P<0.001 vs 0, 0.5 pg/ml IL-1ß, P<0.05 vs 5.0 pg/ml IL-1ß.

 


View larger version (14K):
[in this window]
[in a new window]
 
Fig. 2. GEC were incubated in Nu-Serum-free K1 medium with 50.0 pg/ml IL-1ß containing various concentrations of IFN-{gamma} (0.1, 1.0, 10.0 ng/ml) or heparin (0.1, 1.0, 10.0 U/ml) in order to examine the inhibitory effect of these factors against IL-1ß. INF-{gamma} (10.0 ng/ml) (A) and heparin (0.1–10.0 U/ml) (B) inhibited IL-1ß-stimulated GEC proliferation. Values are the mean±SD for six wells, and representative data from one of two experiments are shown respectively. A: *P<0.001 vs Nu-Serum-free K1 medium, **P<0.05 vs Nu-Serum-free K1 medium, P<0.02 vs 0.1 ng/ml IFN-{gamma}. B: *P<0.001 vs Nu-Serum-free K1 medium, **P<0.05 vs 0 U/ml heparin, ***P<0.0001 vs 0 U/ml heparin, P<0.02 vs 0.1 U/ml heParin, ****P<0.0001 vs 0, 0.1 U/ml heparin, P<0.05 vs 1.0 U/ml heparin.

 


View larger version (13K):
[in this window]
[in a new window]
 
Fig. 3. GEC were incubated with K1 medium with or without Nu-Serum and the effects of IFN-{gamma} and heparin on GEC proliferation were evaluated using a MTT method. INF-{gamma} (1.0, 10.0 ng/ml) (A) and Heparin (0.1–10.0 U/ml) (B) inhibited Nu-Serum-stimulated GEC proliferation. Values are the mean±SD for six wells, and representative data from one of two experiments are shown respectively. A: *P<0.05 vs Nu-Serum-free K1 medium, **P<0.02 vs 0, 0.1 ng/ml IFN-{gamma}, ***P<0.05 vs 0, 0.1 ng/ml IFN-{gamma}. B: *P<0.0001 vs Nu-Serum-free K1 medium, **P<0.0001 vs 0 U/ml heparin, ***P<0.0001 vs 0 U/ml heparin, ****P<0.0001 vs 0 U/ml heparin, P<0.001 vs 0.001 vs 0.1 U/ml heparin, P<0.02 vs 1.0 U/ml heparin.

 

Effect of anti-IL-1ß antibody in GEC proliferation
GEC were incubated in Nu-Serum-free K1 medium and K1 medium with anti-IL-1ß antibody for 48 h. GEC proliferation was promoted in K1 medium compared with that in Nu-Serum-free K1 medium (P<0.001). Anti-IL-1ß antibody significantly inhibited GEC proliferation in K1 medium (P<0.05), although its inhibitory effect was partial. Normal goat IgG itself did not suppress GEC proliferation (Figure 4Go).



View larger version (15K):
[in this window]
[in a new window]
 
Fig. 4. Effects of Nu-Serum, anti-IL-1ß antibody and normal goat IgG on GEC growth in K1 medium assessed by a MTT method. Anti-IL-1ß antibody significantly inhibited GEC proliferation. Values are the mean±SD for eight wells, and representative data from one of two experiments are shown respectively. *P<0.001 vs Nu Serum-free K1 medium, P<0.05 vs K1+anti-IL-1ß antibody, **P<0.05 vs K1+anti-IL-1ß antibody.

 

IL-1ß production by GEC
GEC were incubated in Nu-Serum-free K1 medium or K1 medium for 24, 48, and 72 h. IL-1ß was not detected in Nu-Serum-free K1 medium or K1 medium at baseline. The mean level of IL-1ß in the culture supernatants in four wells without Nu-Serum was undetectable after 24 h, 0.175±0.049 pg/µg after 48 h, and 0.110±0.129 pg/µg after 72 h, while the level in the presence of Nu-Serum was undetectable after 24 h, 0.158±0.171 pg/µg after 48 h, and 0.905±0.568 pg/µg after 72 h (P<0.05 vs Nu-Serum-free K1 medium) (Figure 5Go). GEC were incubated with rat IFN-{gamma} (0.1–10.0 ng/ml) or heparin (0.1–10.0 U/ml) for 72 h, and IL-1ß levels in culture supernatants were measured. The mean values of IL-1ß from three wells were 0.99±0.131 pg/µg (0 ng/ml IFN-{gamma}), 0.987±0.121 pg/µg (0.1 ng/ml IFN-{gamma}), 0.877±0.176 pg/µg (1.0 ng/ml IFN-{gamma}), 0.823±0.112 pg/µg (10.0 ng/ml IFN-{gamma}), 0.80±0.046 pg/µg (0 U/ml heparin), 0.70±0.05 pg/µg (0.1 U/ml heparin), 0.72±0.061 pg/µg (1.0 U/ml heparin), and 0.752±0.076 pg/µg (10.0 U/ml heparin). IFN-{gamma} (0.1–10.0 ng/ml) or heparin (0.1–10.0 U/ml) did not affect IL-1ß production by GEC.



View larger version (9K):
[in this window]
[in a new window]
 
Fig. 5. Time course of IL-1ß production by GEC in the absence (•) or presence ({circ}) of Nu-Serum. Nu-Serum significantly stimulated IL-1ß production by GEC by 2-way ANOVA (P<0.05). Values are the mean±SD for four wells.

 

Immunoblot analysis of IL-1ß of GEC
To confirm the existence of IL-1ß in GEC supernatants, we performed immunoblot analysis. A single 17 kD protein reacting with anti-IL-1ß antibody was detected in the reduced samples and its size was compatible with that of IL-1ß (Figure 6Go).



View larger version (39K):
[in this window]
[in a new window]
 
Fig. 6. Immunoblot analysis showing a single 17 kD protein reacted with anti-IL-1ß antibody in the reduced sample.

 

IL-1ß mRNA expression by GEC
PCR amplification of poly A+ RNA of GEC in culture yielded a single band, which is a band of 325 base pair corresponding to predicted size of rat IL-1ß production. cDNA reflecting 5 µg total RNA extracted from rat liver was employed as a positive control, and revealed a band of similar size (Figure 7Go).



View larger version (102K):
[in this window]
[in a new window]
 
Fig. 7. RT-PCR demonstrated mRNA expression of IL-1ß, which is a band of 325 base pair corresponding to predicted size of rat IL-1ß mRNA. Messenger RNA extracted from rat liver was employed as a positive control showed a band of similar size.

 



   Discussion
 Top
 Abstract
 Introduction
 Subjects and methods
 Results
 Discussion
 References
 
In the present study we demonstrated that recombinant IL-1ß stimulated GEC proliferation and anti-IL-1ß neutralizing antibody inhibited proliferation of GEC incubated in K1 medium. Thus both exogenously added and endogenously derived IL-1ß appear to stimulate GEC proliferation. It was also shown that IFN-{gamma} and heparin inhibited GEC proliferation without affecting IL-1ß production by GEC.

Glomerular crescents comprise various kinds of cells, including macrophages, polymorphonuclear leukocytes, and visceral and parietal GEC. A clinical study by Magil et al. showed cellular crescents containing macrophages and parietal cells in anti-glomerular basement membrane diseases and very few macrophages but numerous epithelial cells in immune complex diseases [14,15]. Boucher et al. reported that when the continuity of Bowman's capsule was preserved, most crescent cells were parietal cells, but when the capsule was ruptured, many mononuclear inflammatory cells appeared in the crescents [16]. Although visceral GEC are not a major component of the crescent, the proliferation of visceral GEC, which are stimulated to proliferate by growth factors, cytokines and extracellular matrix, may participate in crescent formation.

The regulation of GEC proliferation is not fully understood. It was reported that epidermal growth factors [17], basic fibroblast growth factor [18], and thrombin [19] promote GEC proliferation. We have reported that cultured GEC produced IL-6, and IL-6 itself augmented GEC proliferation [5]. It was also reported that GEC produced PDGF, although PDGF did not stimulate GEC proliferation [7].

IL-1ß is originally identified as a lymphocyte-activating factor [20]. It is well known that IL-1ß has multiple biological functions and that it is produced by a variety of cells [9]. Lovett et al. first reported that cultured mesangial cells produce IL-1, and mesangial IL-1 acts as an auto-growth factor in mesangial cells [21]. Both IL-1 production and gene expression have been documented to be enhanced in models of inflammatory immune glomerular injury and human glomerulonephritis [22]. Moreover, treatment with an IL-1 receptor antagonist markedly reduces glomerular injury in experimental crescentic glomerulonephritis [23]. However, it has not been reported whether GEC synthesize IL-1ß. In this study, we demonstrated that cultured rat GEC synthesize IL-1ß and, moreover, IL-1ß mRNA is present in GEC. Budde et al. reported that cultured rat GEC secrete soluble factors into the supernate which induce proliferation of quiescent rat mesangial cells [24]. They thought that these growth factors are distinct from IL-6, PDGF, bFGF and other known growth factors including IL-1. Yanagisawa et al. reported that tumour necrosis factor {alpha} accelerated GEC proliferation in a presence of epidermal growth factor, while IL-1ß inhibited GEC proliferation [25]. They used primary cultured GEC. They speculated that IL-1ß strongly stimulated the proliferation of mesangial cells and consequently GEC proliferation was suppressed. In our study, both exogenous and endogenous IL-1ß were shown to stimulate GEC proliferation. It is well known that macrophages and monocytes secrete IL-1ß. Therefore, it is likely that IL-1ß secreted by macrophages and monocytes infiltrated in crescents stimulate GEC proliferation, and then proliferated GEC secrete IL-1ß, which promotes GEC proliferation as an autocrine manner.

Glomerular accumulation of extracellular matrix is an important feature for progressive glomerulosclerosis. Crescents usually become fibrous following cell proliferation. Torbohm et al. reported that IL-1, as well as IL-1 containing monocyte supernatants, increased the synthesis of type IV collagen by cultured GEC [26]. Richardson et al. reported that IL-1ß increased laminin B2 chain mRNA levels in cultured GEC [27]. IL-1ß derived from both monocytes and GEC may be also involved in overproduction of extracellular matrix.

IFN-{gamma} is known to inhibit proliferation of many types of cells including mesangial cells [28]. Heparin is also known to inhibit mesangial cell proliferation [29]. However, it has not been known how IFN-{gamma} and heparin modulate GEC proliferation. In our study, IFN-{gamma} and heparin both inhibited IL-1ß-stimulated GEC proliferation. IFN-{gamma} and heparin also inhibited Nu-Serum-stimulated GEC proliferation. Nu-Serum does not contain IL-1ß. IFN-{gamma} and heparin did not affect IL-1ß production by GEC. We cannot neglect the possibility that IFN-{gamma} and heparin directly blocked IL-1ß activity. However, it is very likely that IFN-{gamma} and heparin may suppress a large range of growth factors including IL-1ß or inhibit the intracellular pathway of GEC proliferation, because IFN-{gamma} and heparin inhibited Nu-Serum-stimulated GEC proliferation without the decrease of IL-1ß production.

In conclusion, the present study demonstrated that cultured rat GEC could secrete IL-1ß and IL-1ß mRNA was present in GEC. IL-1ß accelerated GEC proliferation and anti-IL-1ß antibody inhibited GEC proliferation. Taken together, IL-1ß is an autocrine growth factor for GEC and may play an important role in the regulation of GEC proliferation.



   Notes
 
Correspondence and offprint requests to: Hideaki Yamabe MD, Second Department of Internal Medicine, Hirosaki University School of Medicine, 5 Zaifu-cho, Hirosaki, 036-8562 Japan. Back



   References
 Top
 Abstract
 Introduction
 Subjects and methods
 Results
 Discussion
 References
 

  1. Wardle EN. Cytokine growth factors and glomerulonephritis. Nephron1991; 57: 257–261[Medline]
  2. Floege J, Eng E, Young BA, Johnson RJ. Factors involved in the regulation of mesangial cell proliferation in vitro and in vivo. Kidney Int1993; 39: S47–S54
  3. Yamabe H, Yoshikawa S, Osawa H et al. Tissue factor production by cultured rat glomerular epithelial cells. Nephrol Dial Transplant1993; 8: 519–523[Abstract/Free Full Text]
  4. Natori Y, Natori Y, Nishimura T et al. Production of monocyte chemoattractant protein-I by cultured glomerular epithelial cells: Inhibition by dexamethasone. Exp Nephrol1997; 5: 318–322[Web of Science][Medline]
  5. Osawa H, Yamabe H, Inuma H et al. TGF-ß upregulates Interleukin 6 production by rat glomerular epithelial cells in vitro. Nephrol Dial Transplant1995; 10: 1592–1597[Abstract/Free Full Text]
  6. Tsunoda S, Yamabe H, Osawa H, Fumiko T, Okumura K. Cultured rat glomerular epithelial cells produce transforming growth factor beta which gene expression is enhanced with thrombin. J Am Soc Nephrol1995; 6: 778
  7. Floege J, Johnson RJ, Alpers CE et al. Visceral glomerular epithelial cells can proliferate in vivo and synthesize platelet-derived growth factor B-chain. Am J Pathol1993; 142: 637–650[Abstract]
  8. Johnson RJ, Yamabe H, Chen YP et al. Glomerular epithelial cells secrete a glomerular basement membrane-degrading mettalloproteinase. J Am Soc Nephrol1992; 2: 1388–1397[Abstract]
  9. Lovett DH, Szamel M, Ryan JL, Sterzel RB, Gemsa D, Resch K. Interleukin 1 and the glomerular mesangium. I. Purification and characterization of a mesangial cell-derived autogrowth factor. J Immunol1986; 136: 3700–3705[Abstract]
  10. Harper PA, Robinson JM, Hoover RL, Wright TC, Karnovsky MJ. Improved methods for culturing rat glomerular cells. Kidney Int1989; 26: 875–880
  11. Striker GE, Striker LJ. Biology of disease Glomerular cell culture. Lab Invest1985; 53: 122–131[Web of Science][Medline]
  12. Lowry OH, Rosebrough NJ, Farr AL, Randall RJ. Protein measurement with the Folin phenol reagent. J Biol Chem1951; 193: 265–275[Free Full Text]
  13. Wang CX, Olschowka JA, Wrathall JR. Increase of interleukin-1ß mRNA and protein in the spinal cord following experimental traumatic injury in the rat. Brain Res1997; 759: 190–196[Web of Science][Medline]
  14. Magil AB, Wadsworth LD. Monocyte involvement in glomerular crescent. Lab Invest1982; 47: 160–166[Web of Science][Medline]
  15. Magil AB. Histogenesis of glomerular crescent. Am J Pathol1985; 120: 222–229[Abstract]
  16. Boucher A, Droz D, Adsfer E, Noel LH. Relationship between the integrity of Bowman's capsule and the composition of cellular crescents in human crescentic glomerulonephritis. Lab Invest1987; 56: 526–533[Web of Science][Medline]
  17. Adler S, Chen X, Eng B. Control of glomerular epithelial cell growth in vitro. Kidney Int1990; 37: 1048–1054[Medline]
  18. Takeuchi A, Yoshizawa N, Yamamoto M et al. Basic fibroblast growth factor promotes proliferation of rat glomerular visceral epithelial cells in vitro. Am J Pathol1992; 141: 107–116[Abstract]
  19. Cybulsky AV, McTavish AJ, Papillon J, Takano T. Role of extracellular matrix and Ras in regulation of glomerular epithelial cell proliferation. Am J Pathol1999; 154: 899–908[Abstract/Free Full Text]
  20. March CJ, Mosley B, Larsen A et al. Cloning, sequence and expression of two distinct human interleukin-1 complementary DNAs. Nature1985; 315: 641–647[Medline]
  21. Oppenheim JJ, Kovacs EJ, Matsusima K, Durum SK. There is more than one interleukin 1. Immunol Today1986; 7: 45–56[Web of Science]
  22. Matsumoto K, Dowling JP, Atkins RC. Production of interleukin 1 in glomerular cell cultures from patients with rapidly progressive crescentic glomerulonephritis. Am J Nephrol1988; 8: 463–470[Web of Science][Medline]
  23. Lan HY, Nikolic-Paterson, Zamara M, Vannice JL, Atkins RC. Suppression of experimental crescentic glomerulonephritis by the interleukin-1 antagonist. Kidney Int1993; 43: 479–485[Web of Science][Medline]
  24. Budde K, Neumayer HH, Salant DJ, Cybusky AV, Coleman DL, Sterzel RB. Glomerular epithelial cell products stimulate mesangial cell proliferation in culture. Kidney Int1997; 52: 733–741[Medline]
  25. Yanagisawa M, Imai H, Fukushima Y, Yasuda T, Miura AB, Nakamoto Y. Effects of tumor necrosis factor alpha and interleukin 1 beta on the proliferation of cultured glomerular epithelial cells. Virchows Arch1994; 424: 581–586[Medline]
  26. Torbohm I, Berger B, Schonermark M, Von Kempis J, Roter K, Hansch GM. Modulation of collagen synthesis in human glomerular epithelial cells by interleukin 1. Clin exp Immunol1989; 75: 427–431[Medline]
  27. Richardson CA, Gordon KL, Couser WG, Bomsztyk K. IL-1 beta increases laminin B2 chain mRNA levels and activates NF-kappa B in rat glomerular epithelial cells. Am J Physiol1995; 268: F273–F278[Abstract/Free Full Text]
  28. Kakizaki Y, Kraft N, Atkins RC. Differential control of mesangial cell proliferation by interferon-gamma. Clin Exp Immunol1991; 85: 157–163[Web of Science][Medline]
  29. Castellot JJ, Hoover RL, Harper PA, Karnovsky MJ. Heparin and glomerular epithelial cell-secreted heparin-like species inhibit mesangial-cell proliferation. Am J Physiol1985; 120: 247–235
Received for publication: 4. 4.00
Revision received 3. 1.01.
Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Am. J. Physiol. Cell Physiol.Home page
N. Taneja, P. E. Coy, I. Lee, J. M. Bryson, and R. B. Robey
Proinflammatory interleukin-1 cytokines increase mesangial cell hexokinase activity and hexokinase II isoform abundance
Am J Physiol Cell Physiol, August 1, 2004; 287(2): C548 - C557.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (2)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Tateyama, F.
Right arrow Articles by Okumura, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tateyama, F.
Right arrow Articles by Okumura, K.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?