Nephrol Dial Transplant (2001) 16: 923-931
© 2001 European Renal Association-European Dialysis and Transplant Association
Rapid and diverse changes of gene expression in the kidneys of protein-overload proteinuria mice detected by microarray analysis
Department of Internal Medicine and Therapeutics, Graduate School of Medicine (A8), Osaka University, Osaka, Japan
| Abstract |
|---|
|
|
|---|
Background. Microarray is a method that allows the analysis of a large number of genes at the same time. We applied this method to show the difference of gene expression in the kidney caused by proteinuria.
Methods. An experimental mouse model of protein overload was prepared by bovine serum albumin injection. The mRNAs of kidneys isolated after 0, 1, 2, 3 and 4 weeks loading were analysed by Northern blotting. We analysed about 18000 genes by microarray. The expression patterns of the microarray were displayed on control, 1 and 3 weeks of protein overload using the clustering procedure. A clone showing the greatest changes of up-regulation in the kidney was cloned and analysed by in situ hybridization and immunohistochemistry.
Results. Over 1600 kinds of gene expression were confirmed in control kidneys. Proteinuria caused systematic changes of gene expression demonstrated by the cluster analysis. The up-regulation of osteopontin mRNA was shown and confirmed by Northern blot analysis. One of the clones showing the largest changes, AA275245, was isolated and characterized. It revealed that AA275245 was an unreported 3' non-coding region of vinculin mRNA which was associated with cytoskeleton proteins (e.g.
-actinin, talin, F-actin). Immunohistochemistry and in situ hybridization showed that this clone was identified in glomeruli as a mesangial pattern. The detected signal intensity using both methods, however, was virtually identical in control and disease kidney models. All data including images and analysed signal intensities are accessible on the web site.
Conclusion. The microarray analysis revealed that the renal gene expression pattern was changed dynamically in mice with experimentally induced proteinuria within a few weeks.
Keywords: gene expression; kidney; microarray; protein-overload; proteinuria; nephron segment
| Introduction |
|---|
|
|
|---|
Recently, several studies have shown that abundant urinary proteins filtered through the glomerular capillary induced intrinsic renal toxicity [14]. In chronic nephropathies, proteinuria is one of the best predictors of the disease progression towards end-stage renal failure, which is independent of mean arterial blood pressure [5].
In experimental models of overload proteinuria in vivo, repeated intravenous injections of albumin have been shown to increase permeability of glomerular barrier and cause proteinuria [6,7]. These events are followed by tubular changes with infiltration of macrophages and T lymphocytes into the kidney [8,9]. Consequently, interstitial inflammation could trigger fibroblast proliferation and accumulation of extracellular matrix proteins, which may facilitate the progression of renal disease. Several factors including osteopontin, transforming growth factor beta 1 (TGF-ß1), monocyte chemoattractant protein-1 (MCP-1) [10], and intercellular adhesion molecule-1 (ICAM-1) expression have been shown to play important roles in renal damage in rat experimental proteinuria models [1113]. In vitro experiments overloading proximal tubular cells with albumin and other proteins activate the transcription of a number of genes encoding vasoactive and inflammatory molecules that have potentially toxic effects on the kidney. For instance, proximal tubular cells in culture treated with excessive amounts of albumin stimulated the synthesis and release of endothelin-1 (ET-1) [14] and MCP-1. ET-1 and MCP-1 are chemotactic factors for macrophages and have been shown to stimulate both interstitial fibroblast proliferation and extracellular matrix synthesis [10,14,15]. Protein overload also stimulates RANTES (regulated upon activation, normal T cell expressed and secreted) production by proximal tubular cells which is dependent on NF-
B activation [16]. RANTES has a potent chemotactic activity for macrophages, granulocytes, and T lymphocytes [17]. These findings support the hypothesis that proteinuria per se has intrinsic adverse effects in the progression of the kidney diseases independent of other factors. Mice have been commonly used to study the function of particular genes by genetic analysis. Microarray analysis is a powerful tool to reveal the change of the genes expression [1820]. This method involves spotting thousands of cDNA clones on a filter, hybridizing the filters with each labelled mRNA sample, and comparing the relative expression of these clones between the filters [21,22]. Using this method, thousands of genes were examined simultaneously as in Northern blot analysis, or dot blot analysis. The changes of gene expression can be evaluated by the changes of the radioactivity or the intensity of fluorescence in the spot of the gene on the filter.
Recently, the differences of gene expression in cancer cells were analysed using these methods [23,24]. In the present study in which mice were treated with protein overload for up to 4 weeks, we first focused on
-smooth-muscle actin (SM
A) expression because SM
A is a marker of myofibroblasts, which may be a separate phenotype of fibroblast [25]. Myofibroblasts are supposed to secrete components of extracellular matrix actively, leading to fibrotic change of tubulointerstitial compartment [26,27]. We detected that SM
A mRNA expression was increased in the disease model kidney from 1 week after protein overload. It suggests that proteinuria might have some adverse effects on this model kidney. We performed the microarray analysis in order to study the changes of genes expression caused by proteinuria. Our data showed that the expression of genes in the kidney were changed systematically by proteinuria (e.g. the up-regulation of osteopontin mRNA). All analysed data using microarray were accessible on our internet web site (http://www.med.osaka-u.ac.jp/pub/imed1/kidney/array/index.html).
| Subjects and methods |
|---|
|
|
|---|
Animals and protocol of BSA loading
Five-week-old male C57/Bl6 mice weighing around 20 g were purchased from Clea Japan (Osaka, Japan). They were fed with standard mouse chow ad libitum and given free access to water. Experimental mice were given 10 mg/g body weight bovine serum albumin intraperitoneally (Sigma Chemical Company, St Louis, MO, USA) dissolved in saline 5 days in 1 week. The load of BSA was continued to 4 weeks. Control mice were treated with saline only. At 1, 2, 3, and 4 weeks, 24 h after load of BSA, all kidneys were removed for investigation.
Histological analysis
After 1, 2, 3 or 4 weeks load of BSA, the kidneys of experimental mice were removed after perfusing with phosphate-buffered saline (PBS) and then with 4% paraformaldehyde (PFA). After PFA fixation, half of each kidney was made into a specimen by the paraffin sectioning method. The other half of the kidney was dehydrated by 30% sucrose/PBS overnight, frozen in Tissue-Tek OCT compound (Sakura Company, Torrance, USA), and made into specimens by cryostat. SM
A was stained by antibody biotin complex method using anti-SM
A mouse antibody (Immunotech, Marseille, France). Anti-mouse antibody rabbit antibody was used as second antibody (ABC kit, Vector Laboratories, CA, USA) on paraffin specimens.
Northern analysis
Total RNA of kidney was extracted using TRIzol reagent (Life Technologies, MD, USA), according to the manufacturer's instructions. Twenty micrograms of RNAs were electrophoresed and transferred on to Hybond-N nylon membranes (Amersham, Buckinghamshire, UK). The membranes were prehybridized for at least 4 h at 42°C with 200 µg/ml of denatured salmon sperm DNA in 50% formamide, 1% SDS, 5xDenhardt's, 5xSSC. The membranes were then hybridized overnight with oligonucleotides for SM
A labelled with [32P]-
-CTP by T4 polynucleotide kinase. After hybridization, the membranes were washed twice with 1xSSC, 0.1% SDS at 42°C, and then exposed to X-Omat LS film (Kodak) with intensifier screens at -70°C. The membrane was subsequently washed in 0.5% SDS heating at 70°C and was cooled into room temperature. It was prehybridized for 4 h at 65°C with 200 µg/ml of denatured salmon sperm DNA in 0.5% SDS, 10xDenhardt's, 5xSSC, 0.05 mol/l sodium phosphate buffer. It was then hybridized overnight with
[32P]-dCTP probe for mouse G3PDH. The membrane was washed twice with 0.1% SSC, 0.1% SDS at 60°C, and was exposed to X-Omat LS film with intensifier screens at -70°C. Oligonucleotides for SM
A were prepared according to the previous report using 3'-UT region [28]. To prepare the probe for G3PDH cDNA [29], polymerase chain reaction (PCR) was performed. The primers for PCR were designed to amplify 1013 bp sequences spanning 5'ACAGCCCGCATCTTCTT3' and 5'CTACAGCAACAGGGTGG3'. The PCR products were subcloned into pBluescript, and the sequence was confirmed to be identical to that of mouse G3PDH (data not shown).
cDNA microarray analysis
In control kidneys, 1 week or 3 weeks after BSA loading, the expression of mRNA was analysed by the cDNA microarray method. Each polyA mRNA was purified from eight kidneys using Poly (A) Pure Kit (Ambion, TX, USA).
We obtained the filter of Gene Discovery Array (Genome Systems, St Louis, USA). The information of the position of cDNA spotted on the filter is provided by accessing http://www.genomesystems.com/GDA/. Each filter was spotted with about 18 000 non-redundant murine cDNA clones from the IMAGE consortium. These clones were picked from the IMAGE library and were re-arrayed into 384-well culture dishes. These cultures were girded onto a nylon membrane in a double spotted pattern at a density of 36 864 spots per filter or 18 376 individual cDNA clones, 32 controls, and 24 orientation markers. Run-off RNA corresponding to Arabidopsis and Drosophila was added to the samples as internal control spotted on the filters. These RNAs were labelled separately and combined with sample first-strand cDNA probes. The data from these spots can be plotted with hybridization intensity vs the RNA amount. The slope of this line was used to normalize the hybridization intensities of all the spots on a filter in order to compare these signals with those from other filters.
Each step was performed according to the manufacturer's procedure. Each mRNA of 2.5 µg was mixed with 50 µmol/l oligo dT and incubated at 70°C for 10 min. After cooling on ice, mRNA was lyophilized on a low heat and reverse-transcribed in 1.4 µl 5x MMLV buffer (Promega, WI, USA), 0.4 µl 10 mmol/l dA/dG/dT mix (Ambion, TX, USA), 4 µl [
-33P] dCTP (New England Nuclear, USA) and 1.2 µl MMLV (Promega). After incubation at 42°C for 1 h, mRNA was degraded by adding 12.5 µl 1 mol/l NaOH. Unincorporated nucleotide and degraded RNA was removed from the labelled probe with a G-50 spin column.
The filters were prehybridized with 15 ml Northern Max hybridization buffer (Ambion, TX, USA) at 42°C for 4 h. After draining the pre-hybridization buffer, a new aliquot of 15 ml of Northern Max hybridization buffer mixed with 2.5 mg denatured salmon sperm DNA was added to the membrane. The probe/control mixture was added, mixed well, and hybridized at 42°C for 14 h. After hybridization, filters were rinsed with 2xSSC at room temperature for 5 min once, and 2xSSC/1% SDS at 68°C for 30 min three times. After washing, the filters were wrapped and imaged on an imager MD STORM (set on monochrome and a resolution of 100 µm) and analysed with Genome Discovery Software (Genome Systems, USA).
The double spotted areas for one cDNA were on the filter. The intensities of radioisotope in two same cDNA were averaged. Clones of signal intensities over 990 were taken to be positively expressed after confirming the actual images. To compare the spots on the two filters, the intensity of each spot was normalized with the internal control spots. Every spot with the intensity ratio greater than 2.0 was considered a significant expression. Actual images and analysed signals were shown on the internet web site (http://www.med.osaka-u.ac.jp/pub/imed1/kidney/array/index.html). The sequences of defined transcripts could be searched though the IMAGE consortium (http://image.llnl.gov/).
The genes which did not express significantly both in control kidneys and kidneys treated by protein overload were omitted from cluster analysis. The other genes were classified according to similarity in pattern of gene expression using Cluster and Treeview Software (http://rana.Stanford.EDU/software/), which uses standard statistical algorithms to rearrange data into categories of similar patterns [30]. This algorithm generates a dendrogram that assembles all elements into a single tree. For any set of genes, similarity scores for all pairs of genes are calculated by the software. The score means the similarity of the pattern of gene expression between a set of genes. Two genes with the highest value which represented the most similar pair of genes are selected and a node is created joining these two genes. The similarity is updated with this new node replacing the two joined elements, and the process was repeated until only a single element remained [30].
cDNA cloning
AA275245 is one of the genes that were up-regulated by the protein overload in microarray analysis. This EST sequence can be obtained from DNA Data Bank of Japan (http://www.ddbj.nig.ac.jp/). The cloning of partial sequence of AA275245 was performed using Marathon ready kidney cDNA (Clontech, USA). Gene Specific Primer (5'CACTCCTGTATTCGTCTGGTTCCTG3') was designed based on the EST sequence of AA275245. DNA sequencing was performed by using ABI310 DNA sequencer (PE Applied Biosystems, USA).
Immunohistochemistry
The frozen specimens were obtained as described in histological analyses. Vinculin, which was found to equal AA275245, was stained by vinculin (N-19) antibody (Santa Cruz, California, USA). Fluorescent anti-goat IgG(H+L) was used as second antibody (Vector Laboratories, California, USA) on frozen specimens.
In situ hybridization
In situ hybridization was performed as described [31]. Frozen sections were obtained as described in histological analyses. The frozen sections were fixed in 4% paraformaldehyde in 0.1 mol/l phosphate buffer for 20 min. After washing with 0.1 mol/l phosphate buffer, the slides were treated with a solution of 10 µg/ml proteinase K in 50 mmol/l TrisHCl, pH 7.5, and 5 mmol/l ethylenediamine tetra-acetic acid (EDTA), pH 8.0, for 1 min at room temperature. They were post-fixed in 4% paraformaldehyde and then treated with 0.25% acetic anhydride and 0.1 mol/l triethanolamine for 10 min. They were rinsed in phosphate buffer (28 mmol/l NaH2PO4, 72 mmol/l Na2HPO4) and dehydrated in increasing concentrations of ethanol. Insert of AA275245 clones were isolated and cloned into pBluescriptII (Stratagene, CA, USA) to be used as probes for the in situ hybridization. To make the 35S-labelled sense or antisense cRNA probe, an in vitro transcription was performed using T7 or T3 RNA polymerase after linearization by cutting with an appropriate restriction enzyme.
Tissue sections were prehybridized for 1 h at 55°C in a buffer (50% deionized formamide, 10% dextran sulphate, 0.3 mol/l NaCl, 1xDenhardt's solution, 20 mmol/l TrisHCl (pH 8.0), 5 mmol/l EDTA (pH 8.0), 0.2% sarcosyl, 200 µg salmon sperm DNA, and 500 µg/ml yeast tRNA), and were hybridized for 24 h at 55°C in the same buffer containing one of the 35S-labelled RNA probes. The probe concentration was 1x106 c.p.m./200 ml per slide. After hybridization, the sections were immersed in 5xSSC at 55°C, rinsed in 50% deionized formamide, 2xSSC at 65°C for 30 min. After rinsing with RNase buffer three times for 10 min each at 37°C, the sections were incubated with 1 mg/ml RNase A in RNase buffer for 10 min at 37°C. After the rinse for 10 min, the sections were washed in 50% formamide, 2xSSC at 65°C for 30 min and rinsed with 2xSSC and 0.1xSSC each for 10 min at room temperature. After dehydration in alcohol and air-drying, the slides were incubated with X-ray-sensitive emulsion for 1 month. The slides were stained with haematoxylin and were photographed by a CCD camera under a microscope.
Data analysis
The results shown are mean±SE for comparisons between two groups, the unpaired t-test (two-tailed) was used, and P<0.05 was taken to be significant.
| Results and Discussion |
|---|
|
|
|---|
The expression of SM
A in kidneys treated with protein overloadTo prepare the protein overload proteinuria model mice, the intraperitoneal injection of BSA was continued for up to 4 weeks. Control mice were treated with saline. The kidneys were obtained for investigations at 0, 1, 2, 3 and 4 weeks of BSA loading. It was shown that serum albumin was significantly elevated by the protein overload treatment, resulting in the temporary elevation of the ratio of proteinuria to creatinine in mice [32]. This observation was confirmed as shown in Figure 1A
|
We first performed Northern blot analysis of SM
A mRNA in the kidneys of protein-overloaded mice. The expression of SM
A was significantly increased from 1 week after protein-overload treatment (Figure 2
A mRNA was maintained up to 4 weeks during treatment by protein overload. The increased expression of SM
A in the kidney suggests that there appeared myofibroblast-like cells [27,33] in which phenotypes were changed and activated by proteinuria. In a variety of tissue injuries, myofibroblasts play important roles in wound healing [25]. Our observation showed that the phenotypic change of the renal cells occurred in this disease model kidney, and that gene expression in the cells could be changed by proteinuria within 1 week. To study whether proteinuria would induce any other changes of gene expression in kidney, we applied the microarray analysis that has been developed recently as a powerful tool to study gene expression on a large scale.
|
Microarray analysis
Microarray analysis was performed as described in Subjects and methods using poly (A)+ mRNA isolated from kidneys of controls 1 and 3 weeks after BSA loading. All of the microarray data including actual images and signal intensity were shown on the internet web site (http://www.med.osaka-u.ac.jp/pub/imed1/kidney/array/index.html). In control kidneys, the expression of over 1600 kinds of genes out of 18 000 transcripts examined was confirmed by this analysis based on the criteria explained in Subjects and methods.
The sequences of defined transcripts could be searched and obtained though the IMAGE consortium (http://image.llnl.gov/). The data from microarray study were analysed and displayed using the clustering procedure as reported by Eisen et al. [30]. The sequences that were not significantly expressed during the experimental procedures were excluded in this analysis. A hierarchical clustering algorithm produces a table of results with the elements of the array shown grouped together based on the similarities in their gene expression patterns. The typical results of the clustering analyses are shown in Figure 3A
, B
. The data tables are presented graphically as coloured image (red, green, black colours indicate respectively up-regulation of gene expression, down-regulation of gene expression, and no significant differences of gene expression compared to that in control). Along the horizontal axis, the analysed genes are arranged as ordered by the clustering algorithm, so that the genes with most similar patterns of expression are placed adjacent to each other [23]. In the left side of Figures 3A
, B
, the results of the cluster analyses were shown as the dendrograms. The representative clusters of up-regulated and down-regulated genes in the kidneys from 1 to 3 weeks of the protein overload treatment were shown in Figure 3A
, B
respectively. The up-regulated genes cluster (Figure 3A
) includes osteopontin, which is a multifunctional protein [34] as a chemotactic and adhesion molecule for macrophages. It promotes macrophage infiltration during interstitial fibrosis and wound healing [35]. The cumulative evidence has shown osteopontin to be one of the important mediators in various renal disease models [3640]. It also has been postulated to play pivotal roles in the progression of human kidney diseases [41,42]. The increased expression of osteopontin was confirmed by Northern analysis in the disease model kidney (Figure 4
). Unfortunately it revealed that SM
A, RANTES, and ICAM-1 sequences were not included or identified on the filters. TGF-ß and MCP-1 were withdrawn from dbEST during preparation of the manuscript. It should be noted that dbEST and the data in the IMAGE consortium are being changed to show updated and corrected data. The representative genes that were up-regulated or down-regulated from control level were shown with their changes and filter images (Figures 5
, 6
). The identified sequences in the kidney, approximately 1600 clones, were relatively small among 18 000 transcripts on the array. This may be explained by the following facts: (i) the numbers of EST sequences of mouse kidney in GenBank dbEST were less than 700 among over 330 000 entries in early 1998 when this microarray was introduced; (ii) the possible deviation of originated tissues of EST clones on the array. All of the EST clones on the array were obtained from the IMAGE consortium. The consortium provided the data concerning the tissue distribution of their EST clones, showing that the largest parts of EST sequences derived from tissues other than the kidney. ESTs of embryonic tissues have been one order larger than those of other tissues, including the kidney. The precise reasons for this, however, remain to be elucidated.
|
|
|
|
Cloning of AA275245 and its distribution in the kidney
AA275245 was one of genes that showed largest changes of up-regulation in the kidney by protein overload proteinuria (Figure 5
). The sequence of AA275245 was obtained from DNA Data Bank of Japan (http://www.ddbj.nig.ac.jp/). To analyse this gene further, cloning of the sequences to 5' direction was performed using Marathon ready cDNA of the mouse kidney. Several clones were obtained and overlapping sequences with AA275245 were confirmed. The sequences from AA275245 was submitted to Gene Bank (accession number AB041262). The FASTA analysis revealed that 5' end of AB041262 had virtually identical region with end of 3' coding region of mouse vinculin mRNA (accession number L18880 [43]), indicating that AB041262 was unreported 3' non-coding region of mouse vinculin mRNA. The expression of mouse vinculin (AA275245) mRNA was localized within the kidney by in situ hybridization using riboprobes prepared from the clone labelled with 35S. The results showed that the transcript of vinculin are mainly located in glomeruli (Figure 7A
). Immunohistochemistry confirmed its expression in glomeruli as a mesangial pattern (Figure 7B
). Vinculin is a cytoskeleton protein associated with the adherents-type junction which associated with F-actin,
-actinin, talin, cadherin, and the integrin family, resulting in a structural and functional link between cellcell, and cellextracellular matrix junctions [44,45]. It has been used as one of the markers of focal adhesion complexes. Vinculin expression has been shown to be modulated in response to various environmental stimuli in fibroblasts [46,47] and to play dynamic roles in the actin cytoskeleton assembly [48,49]. The mRNA is induced and highly concentrated at myotendonus junctions in mechanically stimulated muscle fibres dependent on nitric oxide [50]. Its expression has also been reported in rat Bowmans capsule [51], differentiated cultured podocytes [52], and rat podocytic processes by scanning electron micrographs [53]. Bain et al. [54] presented vinculin expression in predominantly mesangial pattern using immunohistochemistry in human renal biopsy. It seemed to have expression patterns similar to those of mice data, as shown in Figure 7
. The intensity of vinculin expression detected by in situ hybridization and immunohistochemistry, however, seemed to be identical in control and disease model mouse kidneys. In our experiments, the intensity of vinculin expression detected by in situ hybridization and immunohistochemistry was virtually identical in control and disease models. It revealed that considerable amount of vinculin expression was also detected in vessels, which caused difficulty in evaluating the expression by Northern blot analyses of the kidney. One of the vinculin-associated proteins,
-actinin 4, is highly expressed in the glomerular podocytes and forms the actin cytoskeleton complexes [55,56]. Recently, the gene encoding
-actinin 4 has been shown to be responsible for an autosomal dominant form of focal segmental glomerulosclerosis [57]. This suggest that the expression of these actin cytoskeleton proteins might be regulated and consequently be involved in renal injuries or the progression of the kidney diseases.
|
In conclusion, microarray allowed us to perform a large-scale analysis of changes of gene expression. Over 1600 kinds of genes expression were confirmed in the control kidney in this analysis. It was shown that the expression of more than 10% of transcripts was changed by proteinuria. The increased expression of genes such as osteopontin by proteinuria was confirmed. The 5' RACE PCR revealed that one of the clones showing drastic changes of the expression, AA275245, was mouse vinculin, although its expression was virtually identical in control and proteinuria model kidneys. Microarray analysis revealed that proteinuria caused dynamic changes of gene expression in the kidney in a few weeks.
| Acknowledgments |
|---|
This study was supported in part by a Grant-in-Aid for Scientific research from the ministry of Education, Science, and Culture, and the Takeda Medical Research Foundation, Yamanouchi Foundation for Research on Metabolic Disorders, Salt Science, Japan. We thank Ms Naoko Horimoto and Ms Sonoe Watanabe for their expert technical support.
| Notes |
|---|
Correspondence and offprint requests to: Masaru Takenaka MD, Department of Internal Medicine and Therapeutics, Graduate School of Medicine (A8), Osaka University, 22 Yamadaoka, Suita, Osaka 560-0871, Japan.
| References |
|---|
|
|
|---|
- Benigni A, Zoja C, Remuzzi G. The renal toxicity of sustained glomerular protein traffic. Lab Invest1995; 73: 461468[Web of Science][Medline]
- Remuzzi G, Ruggenenti P, Benigni A. Understanding the nature of renal disease progression. Kidney Int1997; 51: 215[Web of Science][Medline]
- Eddy AA. Experimental insights into the tubulointerstitial disease accompanying primary glomerular lesions. J Am Soc Nephrol1994; 5: 12731287[Abstract]
- Remuzzi G. Abnormal protein traffic through the glomerular barrier induces proximal tubular cell dysfunction and causes renal injury. Curr Opin Nephrol Hypertens1995; 4: 339342[Medline]
- Ruggenenti P, Perna A, Mosconi L, Pisoni R, Remuzzi G, on behalf of the Gruppo Italiano di studi epidemiologici in nephrologia (GISEN): Urinary protein excretion rate is the best independent predictor of ESRF in non-diabetic chronic nephropathies. Kidney Int1998; 53: 12091216[Web of Science][Medline]
- Davies D, Brewer D, Hardwicke J. Urinary proteins and glomerular morphometry in protein overload proteinuria. Lab Invest1978; 38: 232243[Web of Science][Medline]
- Remuzzi G, Perna A, Benigni A. Proteins abnormally filtered throughout glomerular capillary have an intrinsic renal toxicity. Contrib Nephrol1996; 118: 164172[Medline]
- Eddy AA, McCulloch LM, Adams JA. Intraglomerular leukocyte recruitment during nephrotoxic serum nephritis in rats. Clin Immunol Immunopathol1990; 57: 441458[Medline]
- Eddy AA. Interstitial nephritis induced by protein-overload proteinuria. Am J Pathol1989; 135: 719733[Abstract]
- Wang Y, Chen J, Chen L, Tay Y-C, Rangan G, Harris D. Induction of monocyte chemoattractant protein-1 in proximal tubule cells by urinary protein. J Am Soc Nephrol1997; 8: 15371545[Abstract]
- Eddy AA, Giachelli CM. Renal expression of genes that promote interstitial inflammation and fibrosis in rats with protein-overload proteinuria. Kidney Int1995; 47: 15461557[Web of Science][Medline]
- Eddy AA, Warren JS. Expression and function of monocyte chemoattractant protein-1 in experimental nephrotic syndrome. Clin Immunol Immunopathol1996; 78: 140151[Medline]
- Abbate M, Zoja C, Corna D, Capitani M, Bertani T, Remuzzi G. In progressive nephropathies, overload of tubular cells with filtered proteins glomerular permeability dysfunction into cellular signals of interstitial inflammation. J Am Soc Nephrol1998; 9: 12131224[Abstract]
- Zoja C, Morigi M, Figliuzzi M et al. Proximal tubular cell synthesis and secretion of endothelin-1 on challenge with albumin and other proteins. Am J Kidney Dis1995; 26: 934941[Web of Science][Medline]
-
Carr M, Roth S, Luther E, Ross S, Springer T. Monocyte chemoattractant protein-1 acts as a T-lymphocyte chemoatractant. Proc Natl Acad Sci USA1994; 91: 36523656
[Abstract/Free Full Text] -
Zoja C, Donadelli R, Colleoni S et al. Protein overload stimulates RANTES production by proximal tubular cells depending on NF-
B activation. Kidney Int1998; 53: 16081615[Web of Science][Medline]
- Schall T, Bacon K, Toy K, Goeddel D. Selective attraction of monocytes and T lymphocytes of the memory phenotype by cytokine RANTES. Nature1990; 347: 669671[Medline]
- Bowtell D. Options availablefrom start to finishfor obtaining expression data by microarray. Nat Genet1999; 21: 2532[Web of Science][Medline]
- Ramsy G. DNA chips; state-of-the-art. Nat Biotechnol1998; 16: 4044[Web of Science][Medline]
-
Takenaka M, Imai E. Functional genomics in nephrology. Nephrol Dial Transplant2000; 15: 139141
[Free Full Text] - Duggan DJ, Bittner M, Chen Y, Meltzer P, Trent JM. Expression profiling using cDNA microarrays. Nat Genet1999; 21: 1014[Web of Science][Medline]
-
Loftus SK, Chen Y, Gooden G et al. Informatic selection of a neural crest-melanocyte cDNA set for microarray analysis. Proc Natl Acad Sci USA1999; 96: 92779280
[Abstract/Free Full Text] -
Perou CM, Jeffrey SS, van de Rijn M et al. Distinctive gene expression patterns in human mammary epithelial cells and breast cancers. Proc Natl Acad Sci USA1999; 96: 92129217
[Abstract/Free Full Text] - Wang K, Gan L, Jeffery E et al. Monitoring gene expression profile changes in ovarian carcinomas using cDNA microarray. Gene1999; 229: 101108[Web of Science][Medline]
- Gabbiani G. The biology of the myofibroblast. Kidney Int1992; 41: 530532[Web of Science][Medline]
- Zhang G, El Nahas A. Alpha-smooth muscle actin positive cell; predictors of experimental renal fibrosis (abstract). J Am Soc Nephrol1994; 5: 824
- Okada H, Strutz F, Danoff TM, Kalluri R, Neilson E. Possible mechanisms of renal fibrosis. Contrib Nephrol1996; 118: 147154[Medline]
-
Kamada S, Nakano Y, Kakunaga T. Structure of 3'-downstream segment of human smooth muscle (aortic-type)
-actin-encoding gene and isolation of the specific DNA probe. Gene1989; 84: 455462[Medline]
- Sabath D, Broome H, Prystowsky M. Glyceraldehyde-3 phosphate dehydrogenase mRNA is a major interleukin 2-induced transcript in a cloned T-helper lymphocyte. Gene1990; 91: 185191[Web of Science][Medline]
-
Eisen MB, Spellman PT, Brown PO, Botstein D. Cluster analysis and display of genome-wide expression patterns. Proc Natl Acad Sci USA1998; 95: 1486314868
[Abstract/Free Full Text] - Yamauchi A, Miyai A, Shimada S et al. Localization and rapid regulation of Na+/myoinositol cotransporter in rat kidney. J Clin Invest1995; 96: 11951201
- Chen A, Wei C, Sheu L, Ding S, Lee W. Induction of proteinuria by adriamycin or bovine serum albumin in the mouse. Nephron1995; 69: 293300[Medline]
- Alpers C, Hudkins K, Gown A, Johnson R. Enhanced expression of "muscle-specific" actin in glomerulonephritis. Kidney Int1992; 41: 11341142[Web of Science][Medline]
- Denhardt DT, Guo X. Osteopontin. A protein with diverse function. FASEB J1993; 7: 14751482[Abstract]
- Giachelli CM, Lombardi D, Johnson RJ, Murry CE, Almeida M. Evidence for a role of osteopontin in macrophage infiltration in response to pathological stimuli in vivo. Am J Pathol1998; 152: 353358[Abstract]
- Diamond JR, Kees-Folts D, Ricardo SD, Pruznak A, Eufemio M. Early and persistent up-regulated expression of renal cortical osteopontin in experimental hydronephrosis. Am J Pathol1995; 146: 14551466[Abstract]
- Giachelli CM, Pichler R, Lombardi D et al. Osteopontin expression in angiotensin II-induced tubulointerstitial nephritis. Kidney Int1994; 45: 515524[Web of Science][Medline]
- Pichler RH, Franceschini N, Young BA et al. Pathogenesis of cyclosporine nephropathy. Roles of angiotensin II and osteopontin. J Am Soc Nephrol1995; 6: 11861196[Abstract]
- Pichler R, Giachelli CM, Lombardi D, Pippin J et al. Tubulointerstitial disease in glomerulonephritis: Potential role of osteopontin (uropontin). Am J Pathol1994; 144: 915926[Abstract]
- Young BA, Burdmann EA, Johnson RJ et al. Cellular proliferation and macrophage influx precede interstitial fibrosis in cyclosporine nephrotoxicity. Kidney Int1995; 48: 439448[Web of Science][Medline]
-
Hudkins KL, Giachelli CM, Cui Y, Couser WG, Johnson RJ, Alpers CE. Osteopontin expression in fetal and mature human kidney. J Am Soc Nephrol1999; 10: 444457
[Abstract/Free Full Text] -
Yu XQ, Fan JM, Nikolic-Paterson DJ et al. IL-1 up-regulates osteopontin expression in experimental crescentic glomerulonephritis in the rat. Am J Pathol1999; 154: 833841
[Abstract/Free Full Text] - Alatortsev V, Kramerova I, Frolov M, Lavrov S, Westphal E. Vinculin gene is non-essential in Drosophila melanogaster. FEBS Lett1997; 413: 197201[Medline]
-
Geiger B, Tokuyasu KT, Dutton AH, Ainger SJ. Vinculin, an intracellular protein localized at specialized sites where microfilament bundles terminate at cell membranes. Proc Natl Acad Sci USA1980; 77: 41274131
[Abstract/Free Full Text] -
Weller PA, Ogryzko EP, Corben EB et al. Complete sequence of human vinculin and assignment of the gene to chromosome 10. Proc Natl Acad Sci USA1990; 87: 56675671
[Abstract/Free Full Text] - Ungar F, Geiger B, Ben-Ze'ev A. Cell contact- and shape-dependent regulation of vinculin synthesis in cultured fibroblasts. Nature1986; 319: 787791[Medline]
- Bendori R, Salomon D, Geiger B. Contact-dependent regulation of vinculin expression in cultured fibroblasts. A study with vinculin-specific cDNA probes. EMBO J1987; 6: 28972905[Web of Science][Medline]
-
Coll JL, Ben-Ze'ev A, Ezzell RM et al. Targeted disruption of vinculin genes in F9 and embryonic stem cells changes cell morphology, adhesion, and locomotion. Proc Natl Acad Sci USA1995; 92: 91619165
[Abstract/Free Full Text] - Ezzell RM, Goldmann WH, Wang N, Parasharama N, Ingber D. Vinculin promotes cell spreading by mechanically coupling integrins to the cytoskeleton. Exp Cell Res1997; 231: 1426[Web of Science][Medline]
-
Tidball J, Spencer M, Wehling M, Lavergne E. Nitric-oxide synthase is a mechanical signal transducer that modulates talin and vinculin expression. J Biol Chem1999; 274: 3315533160
[Abstract/Free Full Text] - Mulholland DJ, Wilson J, Vogl W, Webber W. Distribution of actin bundles in Bowman's capsule of rat kidney. Tissue Cell1999; 31: 610616[Medline]
-
Reiser J, Kriz W, Kretzler M, Mundel P. The glomerular slid diaphragm is a modified adherens junction. J Am Soc Nephrol2000; 11: 18
[Abstract/Free Full Text] - Whiteside CL, Camero R, Munk S, JL. Podocytic cytoskeletal disaggregation and basement-membrane detachment in puromycin aminonucleoside nephrosis. Am J Pathol1993; 142: 16411653[Abstract]
- Bain R, Furness PN, Critchley DR. A quantitative immunofluorescence study of glomerular cell adhesion proteins in proteinuric states. J Pathol1997; 183: 272280[Web of Science][Medline]
- Drenckhahn D, Schnittler H, Nobiling R, Kriz W. Ultrastructural organization of contractile proteins in rat glomerular mesangial cells. Am J Pathol1990; 137: 13431351[Abstract]
-
Kurihara H, Anderson JM, Farquhar MG. Increased Tyr phosphorylation of ZO-1 during modification of tight junctions between glomerular foot processes. Am J Physiol1995; 268: F514524
[Abstract/Free Full Text] -
Kaplan J, Kin S, North K et al. Mutations in ACTN4, encoding
-actinin-4, cause familial focal segmental glomerulosclerosis. Nat Genet2000; 24: 251256[Web of Science][Medline]
Revision received 11.12.00.
This article has been cited by other articles:
![]() |
J. W. Pippin, P. T. Brinkkoetter, F. C. Cormack-Aboud, R. V. Durvasula, P. V. Hauser, J. Kowalewska, R. D. Krofft, C. M. Logar, C. B. Marshall, T. Ohse, et al. Inducible rodent models of acquired podocyte diseases Am J Physiol Renal Physiol, February 1, 2009; 296(2): F213 - F229. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. A. Ishola Jr, D. M. van der Giezen, B. Hahnel, R. Goldschmeding, W. Kriz, H. A. Koomans, and J. A. Joles In mice, proteinuria and renal inflammatory responses to albumin overload are strain-dependent Nephrol. Dial. Transplant., March 1, 2006; 21(3): 591 - 597. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Kretzler, C. D. Cohen, P. Doran, A. Henger, S. Madden, E. F. Grone, P. J. Nelson, D. Schlondorff, and H.-J. Grone Repuncturing the Renal Biopsy: Strategies for Molecular Diagnosis in Nephrology J. Am. Soc. Nephrol., July 1, 2002; 13(7): 1961 - 1972. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. C. Pritchard, L. Hsu, J. Delrow, and P. S. Nelson Project normal: Defining normal variance in mouse gene expression PNAS, November 6, 2001; 98(23): 13266 - 13271. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||










