Nephrol Dial Transplant (2000) 15: 385-388
© 2000 European Renal Association-European Dialysis and Transplant Association
Prevalence of Japanese dialysis patients with an A-to-G mutation at nucleotide 3243 of the mitochondrial tRNALeu(UUR) gene
1 Department of Internal Medicine, Institute of Clinical Medicine, University of Tsukuba and 2 Terumo Corporation R&D Center, Tsukuba, Japan
Correspondence and offprint requests to: Kunihiro Yamagata, MD, Department of Internal Medicine, Institute of Clinical Medicine, University of Tsukuba, 1-1-1, Tenoudai, Tsukuba 3058575, Japan.
| Abstract |
|---|
|
|
|---|
Background. A high prevalence of an A-to-G mutation at nucleotide 3243 of the mitochondrial genome in patients with diabetes mellitus (DM) and/or deafness has been reported previously. We investigated the prevalence of this mutation in Japanese dialysis patients with associated DM and/or deafness.
Methods. We studied 106 dialysis patients with DM, 26 with DM and deafness, and 26 with deafness alone, using peripheral leucocytes to detect an A-to-G transition at nucleotide 3243 of the mitochondrial gene.
Results. We identified this transition in 1 of 26 patients with DM and deafness. None of the 106 DM or 26 dialysis patients with deafness but no DM was positive for this mutation. A 42-year-old male patient on continuous ambulatory peritoneal dialysis (CAPD) who carried this mutation had a 20-year history of sensory hearing loss as well as hypertrophic cardiomyopathy.
Conclusion. We found that a mitochondrial gene mutation at nucleotide 3243 was present in one dialysis patient with NIDDM and deafness. The prevalence of this mutation was found to be below 1% in diabetic end-stage renal disease patients in Japan.
Keywords: deafness; diabetes mellitus; end-stage renal disease; mitochondrial DNA; 3243 point mutation
| Introduction |
|---|
|
|
|---|
Diabetes mellitus (DM) is regarded as the most common primary end-stage renal disease (ESRD) in the USA [1] and Japan [2]. Recently, a high prevalence of diabetic patients with a mutation in a mitochondrial gene [a A-to-G mutation at nucleotide position (np) 3243 of mitochondrial DNA] has been reported [36]. Patients with this mutation often have sensory hearing loss [7]. However, Jansen et al. [8] reported that four cases of this mutation were identified from post-renal transplant patients. All of their patients also exhibited hearing loss and they had been misdiagnosed as having Alport's syndrome. Therefore, we examined the prevalence of the A-to-G mutation at np 3243 of mitochondrial DNA in Japanese dialysis patients complicated with hearing loss and/or DM.
| Subjects and methods |
|---|
|
|
|---|
Subjects
The subjects were 158 ESRD patients with hearing loss and/or DM selected from 1425 ESRD patients undergoing maintenance haemodialysis or continuous ambulatory peritoneal dialysis (CAPD) at a University of Tsukuba-affiliated hospital. Subjects were allocated to one of the following groups: hearing loss, diabetes mellitus and hearing loss and diabetes mellitus together. All subjects underwent screening for the A-to-G mutation at np 3243 of mitochondrial DNA. Informed consent was obtained from all subjects.
Molecular studies
Total DNA was extracted from peripheral leucocytes of individuals in each group. Part of the mitochondrial genome between positions 3130 and 3301 [9] was amplified with a polymerase chain reaction (PCR) in a GeneAmp PCR system 2400 (PerkinElmer Corp., Norwalk, CT, USA). The forward primer was 5'-(3130)AGGACAAGAGAAATAAGGCC(3149)-3', and the reverse primer was 5'-(3301)TAAGAAGAGGAATTGAACCTCTGACCTTAA(3272)-3'. The amplification conditions were 35 cycles of denaturation at 94°C for 30 s, annealing at 55°C for 30 s and extension at 72°C for 1 min, with an initial extra 3 min denaturation at 94°C. The amplified fragments (172 bp) were digested with restriction endonuclease HaeIII (Takara Biomedicals Inc., Japan). An A-to-G mutation at position 3243 caused a sequence alteration from AGCC to GGCC (32433246). Both the alternate and the original sequences of 31463149 (GGCC) were cleaved at these positions using HaeIII. Digested fragments were separated on an 8% polyacrylamide gel. The mutant was characterized by three distinctive fragments of 97, 57 and 18 bp. Whereas two distinctive bands of 154 and 18 bp were shown to denote the normal subjects. The nucleotide sequence was confirmed by sequencing the amplified products using Autocycle Sequencing kit (Amersham Pharmacia Biotech, Sweden) after cloning into a pCR2.1 vector (Invitrogen, CA, USA).The frequency of the A-to-G mutation at np 3243 of mitochondrial DNA was determined by colony direct PCR and RFLP of subloned PCR products, which randomly selected more than 40 colonies in each specimen.
| Results |
|---|
|
|
|---|
The characteristics of our subjects are shown in Table 1
|
|
The patient with the tRNALeu(UUR) 3243 mutation was a 42-year-old male who had undergone CAPD for 13 months prior to the study. He was thin (body weight, 40.8 kg; height, 153 cm) with a lot of body hair on his hands and legs. He had presented bilateral sensory hearing loss since he was 20 years of age and proteinuria since he was 21 years of age. He developed NIDDM at 28 years of age, which was controlled with diet. He also showed hypertrophic cardiomyopathy and Wolff-Parkinson-White syndrome. Figure 2
|
| Discussion |
|---|
|
|
|---|
A mitochondrial gene mutation at np 3243 was originally found in patients with mitochondrial myopathy, encephalopathy, lactic acidosis and stroke-like episodes (MELAS) [10]. However, several studies have suggested that this mutation is associated with DM and/or deafness without neurological involvement [36]. Previous studies concerning this mutation are summarized in Table 2
|
In this study, the prevalence of the mutation at tRNALeu(UUR) 3243 in dialysis patients with DM and/or deafness was 3.8%. However, the overall prevalence was below 1% in dialysis patients with diabetes and/or deafness. The reason for the low prevalence rate was unclear. However, the selection of patients with hearing loss was subjective and some patients may have had senile hearing loss. Moreover, we used peripheral leucocytes to prepare mitochondrial genomes. The degree of heteroplasmy reported differs in various tissues and in various subjects [12,13]. The number of mutated mitochondrial DNA molecules is low in the blood cells of some patients and rarely detectable when compared with fibroblasts, skeletal muscle or epithelial cells from a mouthwash [11]. Our patient showed a 13.3% frequency of the A-to-G mutation at np 3243 of mitochondrial DNA extracted from peripheral leucocytes; that of cardiac muscle was about 4 times greater.
Although our patient's DM was very mild and his blood glucose control was fair, even with glucose-based peritoneal dialysate, he had severe cardiac complications. Damian et al. [14] reported that of eight carriers for the mutation at tRNALeu(UUR) 3243, two developed DM, one presented ESRD and two developed cardiomyopathy during 7 years of follow-up. Yorifuji et al. [15] reported that one patient with the mutation at tRNALeu(UUR) 3243 developed progressive nephropathy followed by the development of DM with growth hormone deficiency. The phenotypes of the mutation at tRNALeu(UUR) 3243 are diverse, another characteristic of mitochondrial diseases. Owing to the life-threatening complications associated with mitochondrial DNA mutations, most patients have a short life expectancy, which may account for the low prevalence rate in this study.
Our patient had proteinuria at 21 years of age. However, his renal histology was unknown. Previous studies have suggested that the renal histological change associated with the mutation at tRNALeu(UUR) 3243 was minor glomerular abnormality [8,16] or focal segmental sclerosis [17,18]. Further studies are needed to confirm the renal histological changes associated with the mutation at tRNALeu(UUR) 3243.
In conclusion, we found that a mitochondrial gene mutation at nucleotide position 3243 was present in one dialysis patient with DM and deafness. The prevalence of this mutation is <1% of diabetic ESRD patients in Japan. Examining the mutation at tRNALeu(UUR) 3243 is a useful way of clarifying the underlying renal disease of ESRD patients with sensory hearing loss.
| Acknowledgments |
|---|
This study was supported by a Research Grant for `Progressive Renal Disease' from `Specially Selected Diseases by Ministry of Health and Welfare Research project' of the Ministry of Health and Welfare of Japan.
| References |
|---|
|
|
|---|
- Incidence and Prevalence of ESRD; USRDS 1998 Annual Data Report. Am J Kidney Dis 1998; 32 [Suppl. 1]: S38S49[Medline]
- An overview of regular dialysis treatment in Japan (as of Dec. 31, 1998). Jpn Soc Dial Ther 1999; 64
- Alcolado JC, Majid A, Brockington M, Sweeney MG, Morgan R, Rees A, Harding AE, Barnett AH. Mitochondrial gene defects in patients with NIDDM. Diabetologia 1994; 37: 372376[Web of Science][Medline]
-
Kadowaki T, Kadowaki H, Mori Y et al. A subtype of diabetes mellitus associated with a mutation of mitochondrial DNA. N Engl J Med 1994; 330: 962968
[Abstract/Free Full Text] - Kishimoto M, Hashiramoto M, Kanda F, Tanaka M, Kasuga M. Mitochondrial mutation in diabetic patient with gastrointestinal symptoms. Lancet 1995; 345: 452 (Letter)[Medline]
- Otabe S, Sakura H, Shimokawa K et al. The high prevalence of the diabetic patients with a mutation in the mitochondrial gene in Japan. J Clin Endocrinol Metab 1994; 79: 768771[Abstract]
- Yamasoba T, Oka Y, Tsukuda K, Nakamura M, Kaga K. Auditory findings in patients with maternally inherited diabetes and deafness harboring a point mutation in the mitochondrial transfer tRNALEU(UUR) gene. Laryngoscope 1996; 106: 4953[Web of Science][Medline]
- Jansen JJ, Maassen JA, van der Woude FJ, Lemmink HA, van den Ouweland JM, 't Hart LM, Smeets HJ, Bruijn JA, Lemkes HH. Mutation in mitochondrial tRNALEU(UUR) gene associated with progressive kidney disease. J Am Soc Nephrol 1997; 8: 11181124[Abstract]
- Anderson S, Bankier AT, Barrell BG et al. Sequence and organization of the human mitochondrial genome. Nature 1981; 290: 457465[Medline]
- Goto Y, Nonaka I, Horai S. A mutation in the tRNALEU(UUR) gene associated with the MELAS subgroup in mitochondrial encephalomyopathies. Nature 1990; 348: 651653[Medline]
- Gerbitz KD, van den Ouweland JM, Maassen JA, Jaksch M. Mitochondrial diabetes mellitus: a review. Biochim Biophys Acta 1995; 1271: 253260[Medline]
- Gerbitz KD, Paprotta A, Jaksch M, Zierz S, Drechsel J. Diabetes mellitus is one of the heterogeneous phenotypic features of a mitochondrial DNA point mutation within the tRNALEU(UUR) gene. FEBS Lett 1993; 321: 194196[Web of Science][Medline]
- Suzuki S, Hinokio Y, Hirai S et al. Diabetes with mitochondrial gene tRNALYS mutation. Diabetes Care 1994; 17: 14281432[Abstract]
- Damian MS, Seibel P, Reichmann H et al. Clinical spectrum of the MELAS mutation in a large pedigree. Acta Neurol Scand 1995; 92: 409415[Web of Science][Medline]
-
Yorifuji T, Kawai M, Momoi T et al. Nephropathy and growth hormone deficiency in a patient with mitochondrial tRNALEU(UUR) mutation. J Med Genet 1996; 33: 621622
[Abstract/Free Full Text] - Suzuki T, Fujino T, Sugiyama M, Ishida M. A case of mitochondrial encephalopathy (MELAS). Jpn J Nephrol 1996; 38: 109114
- Ban S, Mori N, Saito K, Mizukami K, Suzuki T, Shiraishi H. An autopsy case of mitochondrial encepharlopathy (MELAS) with special reference to extra-neuromuscular abnormalities. J Neurol Sci 1992; 92: 818825
- Tomonari H, Yoshida H, Omura K et al. An autopsy case of mitochondrial myopathy, encephalopathy, lactic acidosis and stroke-like episodes (MELAS) undergoing long-term hemodialysis. J Jpn Soc Dial Ther 1996; 29: 10971102
- 't Hart LM, Lemkes HH, Heine RJ et al. Prevalence of maternally inherited diabetes and deafness in diabetic populations in The Netherlands. Diabetologia 1994; 37: 11691170[Web of Science][Medline]
- Odawara M, Sasaki K, Yamashita K. Prevalence and clinical characterization of Japanese diabetes mellitus with A-to-G mutation at nucleotide 3243 on the mitochondrial tRNALEU(UUR) gene. J Clin Endocrinol Metab 1995; 80: 12901294[Abstract]
-
Lee HC, Song YD, Li H et al. Mitochondrial gene transfer ribonucleic acid tRNALEU(UUR) 3243 gene and tRNALys 8344 mutations and diabetes mellitus in Korea. J Clin Endocrinol Metab 1997; 82: 372374
[Abstract/Free Full Text]
Accepted in revised form: 21.10.99
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
B. Guery, G. Choukroun, L.-H. Noel, P. Clavel, A. Rotig, S. Lebon, P. Rustin, C. Bellane-Chantelot, B. Mougenot, J.-P. Grunfeld, et al. The Spectrum of Systemic Involvement in Adults Presenting with Renal Lesion and Mitochondrial tRNA(Leu) Gene Mutation J. Am. Soc. Nephrol., August 1, 2003; 14(8): 2099 - 2108. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Yamagata, K. Muro, J. Usui, M. Hagiwara, H. Kai, Y. Arakawa, Y. Shimizu, C. Tomida, K. Hirayama, M. Kobayashi, et al. Mitochondrial DNA Mutations in Focal Segmental Glomerulosclerosis Lesions J. Am. Soc. Nephrol., July 1, 2002; 13(7): 1816 - 1823. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Spellberg, R. M. Carroll, E. Robinson, and E. Brass mtDNA Disease in the Primary Care Setting Arch Intern Med, November 12, 2001; 161(20): 2497 - 2500. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Blair, C. Redwood, H. Ashrafian, M. Oliveira, J. Broxholme, B. Kerr, A. Salmon, I. Ostman-Smith, and H. Watkins Mutations in the {{gamma}}2 subunit of AMP-activated protein kinase cause familial hypertrophic cardiomyopathy: evidence for the central role of energy compromise in disease pathogenesis Hum. Mol. Genet., May 1, 2001; 10(11): 1215 - 1220. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||




