Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (9)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Yamagata, K.
Right arrow Articles by Koyama, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yamagata, K.
Right arrow Articles by Koyama, A.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Nephrol Dial Transplant (2000) 15: 385-388
© 2000 European Renal Association-European Dialysis and Transplant Association

Prevalence of Japanese dialysis patients with an A-to-G mutation at nucleotide 3243 of the mitochondrial tRNALeu(UUR) gene

Kunihiro Yamagata1, Chie Tomida1, Kazuiro Umeyama2, Ken-ichi Urakami2, Takashi Ishizu1, Kouichi Hirayama1, Michihiro Gotoh1, Tadashi Iitsuka1, Katsumi Takemura1, Hiroshi Kikuchi1, Hideko Nakamura1, Masaki Kobayashi1, Akio Koyama1 and Tsukuba Renal Disease Research Network

1 Department of Internal Medicine, Institute of Clinical Medicine, University of Tsukuba and 2 Terumo Corporation R&D Center, Tsukuba, Japan

Correspondence and offprint requests to: Kunihiro Yamagata, MD, Department of Internal Medicine, Institute of Clinical Medicine, University of Tsukuba, 1-1-1, Tenoudai, Tsukuba 305–8575, Japan.



   Abstract
 Top
 Abstract
 Introduction
 Subjects and methods
 Results
 Discussion
 References
 
Background. A high prevalence of an A-to-G mutation at nucleotide 3243 of the mitochondrial genome in patients with diabetes mellitus (DM) and/or deafness has been reported previously. We investigated the prevalence of this mutation in Japanese dialysis patients with associated DM and/or deafness.

Methods. We studied 106 dialysis patients with DM, 26 with DM and deafness, and 26 with deafness alone, using peripheral leucocytes to detect an A-to-G transition at nucleotide 3243 of the mitochondrial gene.

Results. We identified this transition in 1 of 26 patients with DM and deafness. None of the 106 DM or 26 dialysis patients with deafness but no DM was positive for this mutation. A 42-year-old male patient on continuous ambulatory peritoneal dialysis (CAPD) who carried this mutation had a 20-year history of sensory hearing loss as well as hypertrophic cardiomyopathy.

Conclusion. We found that a mitochondrial gene mutation at nucleotide 3243 was present in one dialysis patient with NIDDM and deafness. The prevalence of this mutation was found to be below 1% in diabetic end-stage renal disease patients in Japan.

Keywords: deafness; diabetes mellitus; end-stage renal disease; mitochondrial DNA; 3243 point mutation



   Introduction
 Top
 Abstract
 Introduction
 Subjects and methods
 Results
 Discussion
 References
 
Diabetes mellitus (DM) is regarded as the most common primary end-stage renal disease (ESRD) in the USA [1] and Japan [2]. Recently, a high prevalence of diabetic patients with a mutation in a mitochondrial gene [a A-to-G mutation at nucleotide position (np) 3243 of mitochondrial DNA] has been reported [36]. Patients with this mutation often have sensory hearing loss [7]. However, Jansen et al. [8] reported that four cases of this mutation were identified from post-renal transplant patients. All of their patients also exhibited hearing loss and they had been misdiagnosed as having Alport's syndrome. Therefore, we examined the prevalence of the A-to-G mutation at np 3243 of mitochondrial DNA in Japanese dialysis patients complicated with hearing loss and/or DM.



   Subjects and methods
 Top
 Abstract
 Introduction
 Subjects and methods
 Results
 Discussion
 References
 
Subjects
The subjects were 158 ESRD patients with hearing loss and/or DM selected from 1425 ESRD patients undergoing maintenance haemodialysis or continuous ambulatory peritoneal dialysis (CAPD) at a University of Tsukuba-affiliated hospital. Subjects were allocated to one of the following groups: hearing loss, diabetes mellitus and hearing loss and diabetes mellitus together. All subjects underwent screening for the A-to-G mutation at np 3243 of mitochondrial DNA. Informed consent was obtained from all subjects.

Molecular studies
Total DNA was extracted from peripheral leucocytes of individuals in each group. Part of the mitochondrial genome between positions 3130 and 3301 [9] was amplified with a polymerase chain reaction (PCR) in a GeneAmp PCR system 2400 (Perkin–Elmer Corp., Norwalk, CT, USA). The forward primer was 5'-(3130)AGGACAAGAGAAATAAGGCC(3149)-3', and the reverse primer was 5'-(3301)TAAGAAGAGGAATTGAACCTCTGACCTTAA(3272)-3'. The amplification conditions were 35 cycles of denaturation at 94°C for 30 s, annealing at 55°C for 30 s and extension at 72°C for 1 min, with an initial extra 3 min denaturation at 94°C. The amplified fragments (172 bp) were digested with restriction endonuclease HaeIII (Takara Biomedicals Inc., Japan). An A-to-G mutation at position 3243 caused a sequence alteration from AGCC to GGCC (3243–3246). Both the alternate and the original sequences of 3146–3149 (GGCC) were cleaved at these positions using HaeIII. Digested fragments were separated on an 8% polyacrylamide gel. The mutant was characterized by three distinctive fragments of 97, 57 and 18 bp. Whereas two distinctive bands of 154 and 18 bp were shown to denote the normal subjects. The nucleotide sequence was confirmed by sequencing the amplified products using Autocycle Sequencing kit (Amersham Pharmacia Biotech, Sweden) after cloning into a pCR2.1 vector (Invitrogen, CA, USA).The frequency of the A-to-G mutation at np 3243 of mitochondrial DNA was determined by colony direct PCR and RFLP of subloned PCR products, which randomly selected more than 40 colonies in each specimen.



   Results
 Top
 Abstract
 Introduction
 Subjects and methods
 Results
 Discussion
 References
 
The characteristics of our subjects are shown in Table 1Go. They consisted of 26 patients with hearing loss, 26 patients with hearing loss and DM, and 106 patients with DM alone. The type of DM was as follows: one patient with hearing loss and DM, four with DM had insulin-dependent diabetes mellitus (IDDM) and the rest had noninsulin-dependent diabetes mellitus (NIDDM). Of the 158 dialysis patients, mutation at tRNALeu(UUR) 3243 was detected in only one (Figure 1Go).


View this table:
[in this window]
[in a new window]
 
Table 1. Characteristics of the subjects
 


View larger version (49K):
[in this window]
[in a new window]
 
Fig. 1. Mitochondrial DNA (mtDNA) fragments (3130–3301) from dialysis patients with DM and/or hearing loss are amplified by a polymerase chain reaction and digested with HaeIII. Among the 158 subjects, only one dialysis patient with DM and sensory hearing loss had the tRNALeu(UUR) 3243 mutation in mtDNA (lane 1). the presence of mutant mtDNA resulted in the formation of 97 and 57 bp fragments. Lanes 2 and 3 indicate control subjects and lane M indicates the DNA size marker.

 
The patient with the tRNALeu(UUR) 3243 mutation was a 42-year-old male who had undergone CAPD for 13 months prior to the study. He was thin (body weight, 40.8 kg; height, 153 cm) with a lot of body hair on his hands and legs. He had presented bilateral sensory hearing loss since he was 20 years of age and proteinuria since he was 21 years of age. He developed NIDDM at 28 years of age, which was controlled with diet. He also showed hypertrophic cardiomyopathy and Wolff-Parkinson-White syndrome. Figure 2Go shows the electron-microscopy findings of his cardiac muscle biopsy specimen. Large and small mitochondria with abnormally developed cristae were observed. The frequency of the A-to-G mutation at np 3243 in mitochondrial DNA extracted from peripheral leucocytes was 13.3%, while mitochondrial DNA extracted from a cardiac biopsy specimen was 54.5%. His mother also had renal disease and deafness, however, DNA analysis was not performed because she refused.



View larger version (165K):
[in this window]
[in a new window]
 
Fig. 2. Electron-microscopy findings of the patient's cardiac muscle biopsy specimen. Large and small mitochondria with abnormally developed cristae were observed. (Original magnification 10000x.)

 


   Discussion
 Top
 Abstract
 Introduction
 Subjects and methods
 Results
 Discussion
 References
 
A mitochondrial gene mutation at np 3243 was originally found in patients with mitochondrial myopathy, encephalopathy, lactic acidosis and stroke-like episodes (MELAS) [10]. However, several studies have suggested that this mutation is associated with DM and/or deafness without neurological involvement [36]. Previous studies concerning this mutation are summarized in Table 2Go. The prevalence of this mutation is approximately 1.5% of the diabetic population throughout the world [11]. In addition, the prevalence of this type of mitochondrial diabetes combined with deafness is >60% [4]. Jansen et al. [8] reported that four cases of this mutation were identified from post-renal transplant patients, and one of 63 suspected Alport's syndrome patients showed heteroplasmy for the 3243 mutation. All of their patients also had hearing loss and were misdiagnosed with Alport's syndrome [8]. Alport's syndrome is associated with deafness and hereditary familial congenital nephritis, X-linked inheritance is the most common mode of transmission. Male patients with Alport's syndrome are often infertile, most cases are maternally transmitted, due to the development of severe diseases. These similarities are one reason for misdiagnosing Alport's syndrome and mitochodrial gene disease, which is exclusively maternally transmitted with deafness.


View this table:
[in this window]
[in a new window]
 
Table 2. Prevalence of an A-to-G mutation at nucleotide 3243 of the mitochondrial tRNALeu(UUR) gene among diabetic and other diseased patients
 
In this study, the prevalence of the mutation at tRNALeu(UUR) 3243 in dialysis patients with DM and/or deafness was 3.8%. However, the overall prevalence was below 1% in dialysis patients with diabetes and/or deafness. The reason for the low prevalence rate was unclear. However, the selection of patients with hearing loss was subjective and some patients may have had senile hearing loss. Moreover, we used peripheral leucocytes to prepare mitochondrial genomes. The degree of heteroplasmy reported differs in various tissues and in various subjects [12,13]. The number of mutated mitochondrial DNA molecules is low in the blood cells of some patients and rarely detectable when compared with fibroblasts, skeletal muscle or epithelial cells from a mouthwash [11]. Our patient showed a 13.3% frequency of the A-to-G mutation at np 3243 of mitochondrial DNA extracted from peripheral leucocytes; that of cardiac muscle was about 4 times greater.

Although our patient's DM was very mild and his blood glucose control was fair, even with glucose-based peritoneal dialysate, he had severe cardiac complications. Damian et al. [14] reported that of eight carriers for the mutation at tRNALeu(UUR) 3243, two developed DM, one presented ESRD and two developed cardiomyopathy during 7 years of follow-up. Yorifuji et al. [15] reported that one patient with the mutation at tRNALeu(UUR) 3243 developed progressive nephropathy followed by the development of DM with growth hormone deficiency. The phenotypes of the mutation at tRNALeu(UUR) 3243 are diverse, another characteristic of mitochondrial diseases. Owing to the life-threatening complications associated with mitochondrial DNA mutations, most patients have a short life expectancy, which may account for the low prevalence rate in this study.

Our patient had proteinuria at 21 years of age. However, his renal histology was unknown. Previous studies have suggested that the renal histological change associated with the mutation at tRNALeu(UUR) 3243 was minor glomerular abnormality [8,16] or focal segmental sclerosis [17,18]. Further studies are needed to confirm the renal histological changes associated with the mutation at tRNALeu(UUR) 3243.

In conclusion, we found that a mitochondrial gene mutation at nucleotide position 3243 was present in one dialysis patient with DM and deafness. The prevalence of this mutation is <1% of diabetic ESRD patients in Japan. Examining the mutation at tRNALeu(UUR) 3243 is a useful way of clarifying the underlying renal disease of ESRD patients with sensory hearing loss.



   Acknowledgments
 
This study was supported by a Research Grant for `Progressive Renal Disease' from `Specially Selected Diseases by Ministry of Health and Welfare Research project' of the Ministry of Health and Welfare of Japan.



   References
 Top
 Abstract
 Introduction
 Subjects and methods
 Results
 Discussion
 References
 

  1. Incidence and Prevalence of ESRD; USRDS 1998 Annual Data Report. Am J Kidney Dis 1998; 32 [Suppl. 1]: S38–S49[Medline]
  2. An overview of regular dialysis treatment in Japan (as of Dec. 31, 1998). Jpn Soc Dial Ther 1999; 64
  3. Alcolado JC, Majid A, Brockington M, Sweeney MG, Morgan R, Rees A, Harding AE, Barnett AH. Mitochondrial gene defects in patients with NIDDM. Diabetologia 1994; 37: 372–376[ISI][Medline]
  4. Kadowaki T, Kadowaki H, Mori Y et al. A subtype of diabetes mellitus associated with a mutation of mitochondrial DNA. N Engl J Med 1994; 330: 962–968[Abstract/Free Full Text]
  5. Kishimoto M, Hashiramoto M, Kanda F, Tanaka M, Kasuga M. Mitochondrial mutation in diabetic patient with gastrointestinal symptoms. Lancet 1995; 345: 452 (Letter)[Medline]
  6. Otabe S, Sakura H, Shimokawa K et al. The high prevalence of the diabetic patients with a mutation in the mitochondrial gene in Japan. J Clin Endocrinol Metab 1994; 79: 768–771[Abstract]
  7. Yamasoba T, Oka Y, Tsukuda K, Nakamura M, Kaga K. Auditory findings in patients with maternally inherited diabetes and deafness harboring a point mutation in the mitochondrial transfer tRNALEU(UUR) gene. Laryngoscope 1996; 106: 49–53[ISI][Medline]
  8. Jansen JJ, Maassen JA, van der Woude FJ, Lemmink HA, van den Ouweland JM, 't Hart LM, Smeets HJ, Bruijn JA, Lemkes HH. Mutation in mitochondrial tRNALEU(UUR) gene associated with progressive kidney disease. J Am Soc Nephrol 1997; 8: 1118–1124[Abstract]
  9. Anderson S, Bankier AT, Barrell BG et al. Sequence and organization of the human mitochondrial genome. Nature 1981; 290: 457–465[Medline]
  10. Goto Y, Nonaka I, Horai S. A mutation in the tRNALEU(UUR) gene associated with the MELAS subgroup in mitochondrial encephalomyopathies. Nature 1990; 348: 651–653[Medline]
  11. Gerbitz KD, van den Ouweland JM, Maassen JA, Jaksch M. Mitochondrial diabetes mellitus: a review. Biochim Biophys Acta 1995; 1271: 253–260[Medline]
  12. Gerbitz KD, Paprotta A, Jaksch M, Zierz S, Drechsel J. Diabetes mellitus is one of the heterogeneous phenotypic features of a mitochondrial DNA point mutation within the tRNALEU(UUR) gene. FEBS Lett 1993; 321: 194–196[Medline]
  13. Suzuki S, Hinokio Y, Hirai S et al. Diabetes with mitochondrial gene tRNALYS mutation. Diabetes Care 1994; 17: 1428–1432[Abstract]
  14. Damian MS, Seibel P, Reichmann H et al. Clinical spectrum of the MELAS mutation in a large pedigree. Acta Neurol Scand 1995; 92: 409–415[ISI][Medline]
  15. Yorifuji T, Kawai M, Momoi T et al. Nephropathy and growth hormone deficiency in a patient with mitochondrial tRNALEU(UUR) mutation. J Med Genet 1996; 33: 621–622[Abstract]
  16. Suzuki T, Fujino T, Sugiyama M, Ishida M. A case of mitochondrial encephalopathy (MELAS). Jpn J Nephrol 1996; 38: 109–114
  17. Ban S, Mori N, Saito K, Mizukami K, Suzuki T, Shiraishi H. An autopsy case of mitochondrial encepharlopathy (MELAS) with special reference to extra-neuromuscular abnormalities. J Neurol Sci 1992; 92: 818–825
  18. Tomonari H, Yoshida H, Omura K et al. An autopsy case of mitochondrial myopathy, encephalopathy, lactic acidosis and stroke-like episodes (MELAS) undergoing long-term hemodialysis. J Jpn Soc Dial Ther 1996; 29: 1097–1102
  19. 't Hart LM, Lemkes HH, Heine RJ et al. Prevalence of maternally inherited diabetes and deafness in diabetic populations in The Netherlands. Diabetologia 1994; 37: 1169–1170[Medline]
  20. Odawara M, Sasaki K, Yamashita K. Prevalence and clinical characterization of Japanese diabetes mellitus with A-to-G mutation at nucleotide 3243 on the mitochondrial tRNALEU(UUR) gene. J Clin Endocrinol Metab 1995; 80: 1290–1294[Abstract]
  21. Lee HC, Song YD, Li H et al. Mitochondrial gene transfer ribonucleic acid tRNALEU(UUR) 3243 gene and tRNALys 8344 mutations and diabetes mellitus in Korea. J Clin Endocrinol Metab 1997; 82: 372–374[Abstract/Free Full Text]
Received for publication: 15. 3.99
Accepted in revised form: 21.10.99


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J. Am. Soc. Nephrol.Home page
B. Guery, G. Choukroun, L.-H. Noel, P. Clavel, A. Rotig, S. Lebon, P. Rustin, C. Bellane-Chantelot, B. Mougenot, J.-P. Grunfeld, et al.
The Spectrum of Systemic Involvement in Adults Presenting with Renal Lesion and Mitochondrial tRNA(Leu) Gene Mutation
J. Am. Soc. Nephrol., August 1, 2003; 14(8): 2099 - 2108.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
K. Yamagata, K. Muro, J. Usui, M. Hagiwara, H. Kai, Y. Arakawa, Y. Shimizu, C. Tomida, K. Hirayama, M. Kobayashi, et al.
Mitochondrial DNA Mutations in Focal Segmental Glomerulosclerosis Lesions
J. Am. Soc. Nephrol., July 1, 2002; 13(7): 1816 - 1823.
[Abstract] [Full Text] [PDF]


Home page
Arch Intern MedHome page
B. Spellberg, R. M. Carroll, E. Robinson, and E. Brass
mtDNA Disease in the Primary Care Setting
Arch Intern Med, November 12, 2001; 161(20): 2497 - 2500.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
E. Blair, C. Redwood, H. Ashrafian, M. Oliveira, J. Broxholme, B. Kerr, A. Salmon, I. Ostman-Smith, and H. Watkins
Mutations in the {{gamma}}2 subunit of AMP-activated protein kinase cause familial hypertrophic cardiomyopathy: evidence for the central role of energy compromise in disease pathogenesis
Hum. Mol. Genet., May 1, 2001; 10(11): 1215 - 1220.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (9)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Yamagata, K.
Right arrow Articles by Koyama, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yamagata, K.
Right arrow Articles by Koyama, A.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?